ID: 930764218

View in Genome Browser
Species Human (GRCh38)
Location 2:55068300-55068322
Sequence TGATGTTACTAGATGATGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 183}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930764218 Original CRISPR TGATGTTACTAGATGATGCA TGG (reversed) Intronic
901412163 1:9092054-9092076 TGCCGTTAATAGATGATGGATGG - Intergenic
904407871 1:30305265-30305287 TGTGGTCACCAGATGATGCAGGG - Intergenic
906042843 1:42802377-42802399 TGATGTTACAAAATCATGCATGG + Intergenic
906079749 1:43077419-43077441 TGGTGTTAGGAGATGAGGCATGG - Intergenic
906167876 1:43700824-43700846 TGATGTTATAAAAGGATGCATGG - Intronic
908265068 1:62370429-62370451 TGATGTTACAATATCATACATGG - Intergenic
910042520 1:82869993-82870015 TGATGTTACAAAATTATACATGG + Intergenic
910478087 1:87629021-87629043 TGATATTACAAAATTATGCATGG - Intergenic
910616175 1:89200808-89200830 TGACGTTAGTAGATCATACAGGG + Intergenic
912965565 1:114233936-114233958 TCATGTTACAAAATAATGCATGG + Intergenic
913424513 1:118712579-118712601 TGATGTGACAAGATTATGTAGGG + Intergenic
913659649 1:120994858-120994880 TGTGGTCACCAGATGATGCAAGG + Intergenic
914011010 1:143777982-143778004 TGTGGTCACCAGATGATGCAAGG + Intergenic
914166820 1:145183125-145183147 TGTGGTCACCAGATGATGCAAGG - Intergenic
914649630 1:149686637-149686659 TGTGGTCACCAGATGATGCAAGG + Intergenic
916160038 1:161901869-161901891 TGATGTTACAAAATCATGCATGG - Intronic
916643271 1:166755275-166755297 TGATTTTTGTATATGATGCAAGG - Intergenic
917340543 1:173972997-173973019 TGTTGTTATGTGATGATGCAAGG + Intronic
919501987 1:198348715-198348737 TCATTTTACTTAATGATGCATGG + Intergenic
920980023 1:210824842-210824864 TGATATTACAAGATAATGCTGGG - Intronic
921042413 1:211446615-211446637 TGATGTTACAAAATCATGCATGG - Intergenic
923892455 1:238230862-238230884 TGATGTTACAAAATCATTCATGG + Intergenic
1064094188 10:12410970-12410992 TGATGTTTCTAGAGAGTGCATGG + Intronic
1066310767 10:34193874-34193896 TGATGTTAGTAGAAAATTCAGGG - Intronic
1066601318 10:37110560-37110582 TGATGTTGCTAGGTGATGTTGGG + Intergenic
1068133242 10:52921964-52921986 TGATGTTACTAGAGGCTGGGGGG - Intergenic
1072761284 10:98059012-98059034 TGATGTTCCTATGGGATGCAAGG - Intergenic
1072833182 10:98681436-98681458 TGATGTTATAAAATCATGCATGG + Intronic
1073013521 10:100380460-100380482 TAATGTTACAAAATCATGCATGG + Intergenic
1076262849 10:129082882-129082904 TTATGTTACAAAATGATGCATGG - Intergenic
1076932310 10:133540235-133540257 TGATGTGACTCGACAATGCAAGG + Intronic
1078976312 11:16482313-16482335 TGATGTTACAAAGTCATGCATGG - Intronic
1080797321 11:35576913-35576935 CGATGTTACAAAATCATGCATGG + Intergenic
1081248003 11:40793434-40793456 TGATGTTACTATATAATTAATGG - Intronic
1082000647 11:47392091-47392113 TGAAGGTACAAGATGAAGCAAGG + Intergenic
1089205184 11:116755414-116755436 TGATGTTATAAAATCATGCATGG + Intronic
1090164146 11:124529295-124529317 GTATGTGGCTAGATGATGCAGGG - Intergenic
1091857014 12:3748303-3748325 AGGTGTTTCTAGAAGATGCATGG - Intronic
1092267248 12:6991388-6991410 TGATGTTACAAAGTCATGCATGG - Intronic
1095598547 12:43988265-43988287 TCATTTTACTAGATGCTGCCAGG - Intronic
1099092404 12:78329667-78329689 TGATGCTTCTACATGGTGCAAGG + Intergenic
1100533331 12:95481012-95481034 TAATGTTTCTAGATAGTGCAAGG + Intronic
1101648787 12:106655788-106655810 TGATGTCAGTGGATGATGGAAGG + Intronic
1103424355 12:120819290-120819312 TGATGTTACAAAATCATCCATGG - Intronic
1105073957 12:133259100-133259122 TGATATAACTAAATGCTGCAAGG + Intergenic
1106333290 13:28760020-28760042 TGATGTTATAAAATCATGCATGG + Intergenic
1108964860 13:56285508-56285530 TGATTTTTGTATATGATGCAAGG + Intergenic
1110036047 13:70685817-70685839 TGGTATTACAAGATCATGCATGG + Intergenic
1113227378 13:108174062-108174084 TGATTTTTGTAGATGATGTAAGG - Intergenic
1113567048 13:111325432-111325454 TGATGTTTCTAGAGGGAGCAGGG + Intronic
1114508406 14:23235805-23235827 TGATGTTACAAAATCGTGCATGG + Intronic
1115277891 14:31628293-31628315 TGATGTTATAAAATCATGCATGG - Intronic
1116198469 14:41758979-41759001 TGAAGGTGCTAGATGCTGCAGGG + Intronic
1116606856 14:47010073-47010095 TGATGTTACAAGATCATTAATGG - Intronic
1116932908 14:50707777-50707799 TGATGTTACAAAATCATGCATGG - Intergenic
1117529627 14:56647005-56647027 TGAGGTTTTTAGATGTTGCAGGG - Intronic
1118795087 14:69135881-69135903 TGATGTTATAAAATGATGCATGG + Intronic
1119076193 14:71641872-71641894 TGAAGCTGTTAGATGATGCAGGG + Intronic
1120150484 14:81027401-81027423 TAACTTTACTAGATTATGCATGG - Intronic
1124619532 15:31265889-31265911 TGATGTGCCTTGATGGTGCAAGG + Intergenic
1124973072 15:34509196-34509218 TGATGTTATAATATCATGCAAGG + Intergenic
1126530585 15:49706336-49706358 TGATTTTATTACATGATGAAGGG - Intergenic
1128602112 15:69004494-69004516 TGATATGACTAAATGCTGCAAGG - Intronic
1128713024 15:69886135-69886157 TGATCTTCCCAGAGGATGCAAGG + Intergenic
1129508250 15:76101106-76101128 GGATGTTAGTAGATGATGGCTGG + Intronic
1130508065 15:84565300-84565322 TGATGTTATAATATCATGCAAGG + Intergenic
1137428058 16:48396451-48396473 TCATGTTACTAGATAATTCAGGG - Intronic
1143310507 17:5984310-5984332 TGATGTTACAAAGTAATGCATGG + Intronic
1144252574 17:13433618-13433640 TTATTTTTCTATATGATGCATGG + Intergenic
1148232023 17:45942266-45942288 TGTTTTCACTTGATGATGCATGG + Intronic
1150058597 17:62043303-62043325 TGATGTCACTAGAATTTGCATGG - Intronic
1151076114 17:71274454-71274476 TGAAGTTCCTTGAAGATGCACGG - Intergenic
1151095067 17:71487812-71487834 GGATGTTACAAAATCATGCAAGG + Intergenic
1153147015 18:2044920-2044942 GAATGTTACTAGAGGATGAATGG + Intergenic
1153282796 18:3429677-3429699 TGATGTTACAAAATCACGCATGG + Intronic
1153406086 18:4741172-4741194 TCATGTTACCAGATGAGACAGGG - Intergenic
1154966065 18:21357639-21357661 TGATTTTTCTATATGATGTAAGG + Intronic
1155974311 18:32111453-32111475 TAATATTACTAGAGGAAGCATGG - Intronic
1158569569 18:58586013-58586035 TGATGTTACAAAATCATGCATGG - Intronic
1159959727 18:74546165-74546187 TTACGTTTCTAGATGATGGAAGG + Intronic
1165016293 19:32882653-32882675 TTAGGTTACCAGTTGATGCAGGG - Intronic
1165208557 19:34213452-34213474 TTATGTACCTAGATGATTCAGGG - Intronic
926042355 2:9683734-9683756 TTATGTTACAAAATCATGCATGG + Intergenic
927228616 2:20797123-20797145 TTATGTTAATAGATGCTGAACGG + Intronic
927327059 2:21817355-21817377 TGATTTTAAAAGATGATGCCTGG + Intergenic
928955144 2:36858456-36858478 TTATCTTACTATATGATGGATGG + Intronic
929521006 2:42650893-42650915 TGCTGTCATTAGGTGATGCATGG - Intronic
930764218 2:55068300-55068322 TGATGTTACTAGATGATGCATGG - Intronic
933688812 2:85163408-85163430 TGATGTGACTGGGTGATGGAGGG - Intronic
934679557 2:96273242-96273264 TGATGTTACAAAATCATGCATGG + Intronic
936268568 2:111030491-111030513 TGATGTTGCTAAATTATACATGG + Intronic
937702951 2:124884766-124884788 TAATGTTGATAGATGAGGCAAGG - Intronic
937843250 2:126548404-126548426 GAATGTTACTAGATGAATCATGG + Intergenic
941868138 2:170355902-170355924 TTTTTTTACTAGATGATGTAAGG + Intronic
943372829 2:187036929-187036951 TGATATGACTAAATGATACAAGG - Intergenic
943715299 2:191144964-191144986 AAATATTAATAGATGATGCATGG - Intronic
945107930 2:206333896-206333918 TAATGTTACAAAATCATGCATGG - Intergenic
946668431 2:222075748-222075770 TGATGTTACAAACTTATGCATGG + Intergenic
946806632 2:223477092-223477114 TGTGGTTGCTAGATGATGCAGGG + Intergenic
1169665724 20:8033456-8033478 GGATGTCACTAGATGGTGCAGGG - Intergenic
1169841712 20:9944986-9945008 TGATGTGACTAAATGCTGCAAGG - Intergenic
1173490976 20:43481168-43481190 TGATGTGACTAAATGCTACAAGG - Intergenic
1175765777 20:61591736-61591758 TGATGCTACAAAATTATGCATGG - Intronic
1177147229 21:17419960-17419982 TGACTTTACTAGATGAAACAAGG - Intergenic
1177922508 21:27169979-27170001 TAATGGTTCTAGATGAAGCAAGG - Intergenic
1179662562 21:42886532-42886554 TGATGTTTCTAGATGTTCCATGG + Intronic
1179821754 21:43941074-43941096 TGATGGTACCAGGTGGTGCAGGG + Intronic
1183576684 22:38695113-38695135 TGATGTTTCTAAATCAGGCATGG + Intronic
949305655 3:2637575-2637597 TGATGTTTCTTGTTGAGGCAGGG - Intronic
951845682 3:27081743-27081765 TGCTGGTACCAGATGATGAAAGG - Intergenic
952041088 3:29262635-29262657 GGATGTTACTAGGTTCTGCAGGG + Intergenic
952168238 3:30775606-30775628 AGTTGTTACTAGATCAGGCAAGG + Intronic
954838094 3:53488672-53488694 TAATGTTACCAAATCATGCATGG + Intergenic
958718211 3:97813063-97813085 TGAAGTTACTACTTGATCCATGG + Intergenic
958734007 3:97988992-97989014 TGGTGTTGGTAGATGGTGCATGG + Intronic
959021280 3:101189990-101190012 TGATGTTACAAAATCATGCATGG + Intergenic
961604608 3:128084296-128084318 TGAAGTTACTGGATGGTACAAGG + Intronic
961903967 3:130243171-130243193 AGATGTCTCTAGCTGATGCATGG - Intergenic
962298741 3:134217768-134217790 GGATGGTACTAGAAGGTGCAAGG + Intronic
965383592 3:168019884-168019906 TGATGTTACTAGATGAACAGAGG - Intronic
966556365 3:181265345-181265367 GGATGTTACCAAATCATGCATGG + Intergenic
969080510 4:4614243-4614265 TGCTGTTGCTAGATTTTGCACGG + Intergenic
969948708 4:10811645-10811667 AGCTGTTACTAGATCAGGCAGGG + Intergenic
970149182 4:13070682-13070704 TGATTAAACAAGATGATGCATGG - Intergenic
970265484 4:14279015-14279037 TGATGCTACTAAATGATGAAGGG - Intergenic
972595006 4:40522082-40522104 TGATGTTACAGAATCATGCATGG + Intronic
973668147 4:53184167-53184189 TTATGTTACTAAATGATGTAAGG - Intronic
976368252 4:84255684-84255706 TGATGTTACAAAATTATGCATGG + Intergenic
977279067 4:95016357-95016379 TGATGTTACAAAATTATGCATGG + Intronic
977779388 4:100962731-100962753 TGATGTCACTAGATCCTGGAGGG - Intergenic
978203935 4:106057051-106057073 TGCTGTTACTATGTGATTCAAGG - Intronic
978761702 4:112360086-112360108 GGGGGTTACTAGAAGATGCAGGG - Intronic
979094159 4:116523214-116523236 TTATGTTACAAAATCATGCATGG + Intergenic
980051230 4:128042331-128042353 TGCTATAACTAGATTATGCAGGG + Intergenic
981631295 4:146821755-146821777 TGATGTTACTGGAATATCCAAGG - Intronic
982839239 4:160161196-160161218 TGACTTTACTATATCATGCATGG + Intergenic
984552372 4:181175939-181175961 GGATGATACTAGTTGATCCAAGG - Intergenic
985208150 4:187562940-187562962 TGATGGGGCTAGATAATGCAGGG + Intergenic
986159294 5:5210628-5210650 TAATGTTACTATATGGAGCAAGG - Intronic
990656772 5:57965629-57965651 TGGTGTTACTGGATGCTGGAGGG - Intergenic
990669681 5:58114290-58114312 TCATGATACTACATGATGCTAGG + Intergenic
991435113 5:66590011-66590033 TTATGTTACTAGGAGAAGCAGGG - Intergenic
993392403 5:87335817-87335839 TGTTGTTACAAAATTATGCATGG + Intronic
993736411 5:91481792-91481814 TGATGTTAAGAGATCATGTATGG + Intergenic
996456117 5:123684097-123684119 AGATGTTTCTAGATAATCCATGG + Intergenic
997122129 5:131185494-131185516 TGATGTTACAAAATCATGCATGG - Intronic
998157942 5:139796690-139796712 AGCTGTTCCTAGAGGATGCAGGG + Intronic
998640714 5:144007421-144007443 TGATATGACTAAATGTTGCAAGG - Intergenic
999084574 5:148875965-148875987 TGATGTTACAAAATCATGCAGGG + Intergenic
999811203 5:155128956-155128978 TGATGTCACTAGAGAAGGCACGG - Intergenic
999874627 5:155789162-155789184 TCATGTTACTTAATGATACACGG + Intergenic
1000200114 5:159000801-159000823 TGATGTTACAAAATGATGATGGG + Intronic
1001090798 5:168739199-168739221 TGATATTACAAGATCGTGCATGG + Intronic
1001182582 5:169534332-169534354 TGATGTTACTGGGATATGCAAGG - Intergenic
1002942397 6:1729645-1729667 TGATGTTACGACTTGAAGCAGGG + Intronic
1003035595 6:2638210-2638232 TGATGTGGCTAGATTTTGCAAGG - Intergenic
1011327044 6:86159921-86159943 TGATTTTTGTATATGATGCAAGG - Intergenic
1012355573 6:98309976-98309998 TGATTTTACAAGGTGATACATGG + Intergenic
1012856308 6:104506242-104506264 TAATATTACTAGAATATGCAGGG + Intergenic
1013148691 6:107422981-107423003 AGATGTTACTATATCAGGCAGGG - Intronic
1013426666 6:110018541-110018563 TGGTGTTAATAGATGCTGGAAGG - Intergenic
1015077820 6:129183718-129183740 TGATATGACTTGAGGATGCAGGG - Intronic
1016010498 6:139134255-139134277 GGATGTAACTAGATGTTGCCTGG - Intergenic
1016509977 6:144831443-144831465 TCAAGGTGCTAGATGATGCAAGG + Intronic
1017639777 6:156481446-156481468 TGATGTTACAAAATTATGCATGG - Intergenic
1018251472 6:161875882-161875904 GGATGTTACCAGATGTTCCATGG + Intronic
1021120926 7:16794855-16794877 TGATGGGACTAGAGGCTGCATGG - Intronic
1021459774 7:20873038-20873060 TCAAGTTCCCAGATGATGCAGGG + Intergenic
1021686301 7:23190015-23190037 TGATATTACAAAATTATGCATGG + Intronic
1021888450 7:25163835-25163857 TGATGTTACTTGCAGAGGCACGG - Intronic
1022487161 7:30788367-30788389 TTATGTTACTAAATCATTCAGGG - Intronic
1028352620 7:89867819-89867841 TGATGTTATAAAATCATGCATGG + Intergenic
1028916513 7:96265217-96265239 TGGTGTTACAAAATTATGCATGG - Intronic
1029016549 7:97320664-97320686 TGATATGAATAAATGATGCAAGG - Intergenic
1029045464 7:97623291-97623313 TGAGGCTGATAGATGATGCATGG + Intergenic
1030451142 7:109713610-109713632 TGATGTTTGTATATGATGTAAGG - Intergenic
1030531881 7:110721111-110721133 TGATGATACTAGATGTAGGATGG - Intronic
1032816356 7:135479081-135479103 TGAAATTGCTAGATGAAGCATGG + Intronic
1035494721 7:159314316-159314338 TGATATAACTAAATGCTGCAAGG + Intergenic
1036717952 8:11144359-11144381 TGATGATACTAGATGAGAGATGG + Intronic
1037069424 8:14625291-14625313 AAATGTCACTAGATGATCCATGG - Intronic
1037430299 8:18805646-18805668 TGATGTTACAAAATCATGTAAGG - Intronic
1043039610 8:75245003-75245025 TAATGTTTCTATATGGTGCAAGG + Intergenic
1043982754 8:86659857-86659879 TCAGGTTAGCAGATGATGCAGGG + Intronic
1045151036 8:99408345-99408367 TAGTATTACTAGAGGATGCAAGG + Intronic
1046126598 8:109917465-109917487 AGTTGTTACTAAATCATGCATGG + Intergenic
1046473143 8:114705579-114705601 TGATGTTAAAAAATCATGCAAGG + Intergenic
1047865457 8:129019274-129019296 TGATGTTCCTAGGTGTTGTAGGG + Intergenic
1048656145 8:136538499-136538521 TGATGTTACAAAATCATGCATGG - Intergenic
1050494115 9:6221700-6221722 AGAGGTTACTAGTTGCTGCATGG - Intronic
1050581228 9:7059433-7059455 TGATGTTACCAAATTATGCCTGG + Intronic
1050978642 9:11977737-11977759 TTAAGTGACTAGATGATGGAGGG - Intergenic
1052153660 9:25153820-25153842 TGATTTTTCTAGATTAAGCAGGG - Intergenic
1055371943 9:75609325-75609347 TGATGTTAGAAAATCATGCACGG + Intergenic
1058733303 9:107870714-107870736 TGATGTAACAATATCATGCAGGG - Intergenic
1058870206 9:109194802-109194824 TGATGTTACCAGAGGCTGCAGGG - Intronic
1059530643 9:115032256-115032278 AAATGTTACTAGATTATGAAGGG + Intronic
1059778611 9:117502637-117502659 TGATTTTTCTACATGATGTAAGG + Intergenic
1187989429 X:24853446-24853468 TGATGTTACAAAATCATGCATGG - Intronic
1188095235 X:26013138-26013160 TGATTATACTTAATGATGCAAGG - Intergenic
1188190965 X:27171377-27171399 TGGTCTCACTAGATGATTCATGG + Intergenic
1188985282 X:36763459-36763481 TGGTGTTAGTAGAACATGCATGG - Intergenic
1189264882 X:39706905-39706927 TGATATTTCAAGAGGATGCAGGG - Intergenic
1190536810 X:51437067-51437089 TGAGGTTACAAGATCATGCATGG - Intergenic
1195616070 X:106913050-106913072 TGATGTTACAAAATCATGCATGG + Intronic
1196318003 X:114252365-114252387 TGCTGTTACTAGAACATGCCAGG + Intergenic
1196427649 X:115588096-115588118 TGATGTTACAAAATCAAGCATGG + Intronic
1196487329 X:116227838-116227860 TGATTTTTTTATATGATGCAAGG - Intergenic
1197955326 X:131940236-131940258 TGATGTTACAAAATCATACATGG + Intergenic
1198012295 X:132569928-132569950 TGATGTTACAAAATCATGCTTGG - Intergenic