ID: 930770784

View in Genome Browser
Species Human (GRCh38)
Location 2:55128510-55128532
Sequence TGTCCCCAGGGGACAGAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930770784_930770790 5 Left 930770784 2:55128510-55128532 CCAGATTCTGTCCCCTGGGGACA No data
Right 930770790 2:55128538-55128560 AACTCACTGCAACCTAAAAATGG No data
930770784_930770792 28 Left 930770784 2:55128510-55128532 CCAGATTCTGTCCCCTGGGGACA No data
Right 930770792 2:55128561-55128583 TTTCCACATGTTTATAACCATGG No data
930770784_930770793 29 Left 930770784 2:55128510-55128532 CCAGATTCTGTCCCCTGGGGACA No data
Right 930770793 2:55128562-55128584 TTCCACATGTTTATAACCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930770784 Original CRISPR TGTCCCCAGGGGACAGAATC TGG (reversed) Intergenic
No off target data available for this crispr