ID: 930771455

View in Genome Browser
Species Human (GRCh38)
Location 2:55134320-55134342
Sequence CAGGAGGAGTGGGGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930771455_930771466 4 Left 930771455 2:55134320-55134342 CCCTCTTCCCCCCACTCCTCCTG No data
Right 930771466 2:55134347-55134369 CTTGACAGAAGCTGAGGAAATGG No data
930771455_930771464 -2 Left 930771455 2:55134320-55134342 CCCTCTTCCCCCCACTCCTCCTG No data
Right 930771464 2:55134341-55134363 TGACCTCTTGACAGAAGCTGAGG No data
930771455_930771467 5 Left 930771455 2:55134320-55134342 CCCTCTTCCCCCCACTCCTCCTG No data
Right 930771467 2:55134348-55134370 TTGACAGAAGCTGAGGAAATGGG No data
930771455_930771468 25 Left 930771455 2:55134320-55134342 CCCTCTTCCCCCCACTCCTCCTG No data
Right 930771468 2:55134368-55134390 GGGAAAGCAGATCCTAGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930771455 Original CRISPR CAGGAGGAGTGGGGGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr