ID: 930772013 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:55138357-55138379 |
Sequence | CTCTCTATTCTGAAAGTCGT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
930772012_930772013 | -7 | Left | 930772012 | 2:55138341-55138363 | CCAGATATAATCATTGCTCTCTA | No data | ||
Right | 930772013 | 2:55138357-55138379 | CTCTCTATTCTGAAAGTCGTAGG | No data | ||||
930772010_930772013 | 30 | Left | 930772010 | 2:55138304-55138326 | CCAATACAGTGGTGAGAAGAGGT | No data | ||
Right | 930772013 | 2:55138357-55138379 | CTCTCTATTCTGAAAGTCGTAGG | No data | ||||
930772011_930772013 | 3 | Left | 930772011 | 2:55138331-55138353 | CCAGATCTTTCCAGATATAATCA | No data | ||
Right | 930772013 | 2:55138357-55138379 | CTCTCTATTCTGAAAGTCGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
930772013 | Original CRISPR | CTCTCTATTCTGAAAGTCGT AGG | Intergenic | ||
No off target data available for this crispr |