ID: 930772013

View in Genome Browser
Species Human (GRCh38)
Location 2:55138357-55138379
Sequence CTCTCTATTCTGAAAGTCGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930772012_930772013 -7 Left 930772012 2:55138341-55138363 CCAGATATAATCATTGCTCTCTA No data
Right 930772013 2:55138357-55138379 CTCTCTATTCTGAAAGTCGTAGG No data
930772010_930772013 30 Left 930772010 2:55138304-55138326 CCAATACAGTGGTGAGAAGAGGT No data
Right 930772013 2:55138357-55138379 CTCTCTATTCTGAAAGTCGTAGG No data
930772011_930772013 3 Left 930772011 2:55138331-55138353 CCAGATCTTTCCAGATATAATCA No data
Right 930772013 2:55138357-55138379 CTCTCTATTCTGAAAGTCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930772013 Original CRISPR CTCTCTATTCTGAAAGTCGT AGG Intergenic
No off target data available for this crispr