ID: 930772401

View in Genome Browser
Species Human (GRCh38)
Location 2:55141324-55141346
Sequence CTAACCCCTGGAACCTATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930772401_930772409 2 Left 930772401 2:55141324-55141346 CCTCCATAGGTTCCAGGGGTTAG No data
Right 930772409 2:55141349-55141371 CTTAGACATACTTTTGTGGGGGG No data
930772401_930772406 -1 Left 930772401 2:55141324-55141346 CCTCCATAGGTTCCAGGGGTTAG No data
Right 930772406 2:55141346-55141368 GGACTTAGACATACTTTTGTGGG No data
930772401_930772408 1 Left 930772401 2:55141324-55141346 CCTCCATAGGTTCCAGGGGTTAG No data
Right 930772408 2:55141348-55141370 ACTTAGACATACTTTTGTGGGGG No data
930772401_930772405 -2 Left 930772401 2:55141324-55141346 CCTCCATAGGTTCCAGGGGTTAG No data
Right 930772405 2:55141345-55141367 AGGACTTAGACATACTTTTGTGG No data
930772401_930772407 0 Left 930772401 2:55141324-55141346 CCTCCATAGGTTCCAGGGGTTAG No data
Right 930772407 2:55141347-55141369 GACTTAGACATACTTTTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930772401 Original CRISPR CTAACCCCTGGAACCTATGG AGG (reversed) Intergenic
No off target data available for this crispr