ID: 930773066

View in Genome Browser
Species Human (GRCh38)
Location 2:55147156-55147178
Sequence AAGAGCCCATGGAACTCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930773061_930773066 21 Left 930773061 2:55147112-55147134 CCAACAATTGGAAATATCAAAAA No data
Right 930773066 2:55147156-55147178 AAGAGCCCATGGAACTCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930773066 Original CRISPR AAGAGCCCATGGAACTCTAG AGG Intergenic
No off target data available for this crispr