ID: 930773157

View in Genome Browser
Species Human (GRCh38)
Location 2:55147936-55147958
Sequence ATCATGGATCTCTTTGTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930773157_930773161 8 Left 930773157 2:55147936-55147958 CCATTTACAAAGAGATCCATGAT No data
Right 930773161 2:55147967-55147989 TCTCCACAACGGCCCTGGAAAGG No data
930773157_930773159 -3 Left 930773157 2:55147936-55147958 CCATTTACAAAGAGATCCATGAT No data
Right 930773159 2:55147956-55147978 GATTCAGTTGATCTCCACAACGG No data
930773157_930773160 3 Left 930773157 2:55147936-55147958 CCATTTACAAAGAGATCCATGAT No data
Right 930773160 2:55147962-55147984 GTTGATCTCCACAACGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930773157 Original CRISPR ATCATGGATCTCTTTGTAAA TGG (reversed) Intergenic
No off target data available for this crispr