ID: 930774115

View in Genome Browser
Species Human (GRCh38)
Location 2:55155900-55155922
Sequence CAAGCTAGAAAGGTCTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930774111_930774115 22 Left 930774111 2:55155855-55155877 CCAAAGCAATTTTTTGGGACAAG No data
Right 930774115 2:55155900-55155922 CAAGCTAGAAAGGTCTCCCCAGG No data
930774112_930774115 -10 Left 930774112 2:55155887-55155909 CCAAAGAATTTACCAAGCTAGAA No data
Right 930774115 2:55155900-55155922 CAAGCTAGAAAGGTCTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930774115 Original CRISPR CAAGCTAGAAAGGTCTCCCC AGG Intergenic