ID: 930774552

View in Genome Browser
Species Human (GRCh38)
Location 2:55159304-55159326
Sequence CAGGGCCACACATGGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930774552_930774565 27 Left 930774552 2:55159304-55159326 CCTGCTTCCCATGTGTGGCCCTG No data
Right 930774565 2:55159354-55159376 TACTGCCCCTCCCCACAACAAGG No data
930774552_930774558 -7 Left 930774552 2:55159304-55159326 CCTGCTTCCCATGTGTGGCCCTG No data
Right 930774558 2:55159320-55159342 GGCCCTGAGCCTACTGGGGAAGG No data
930774552_930774559 -6 Left 930774552 2:55159304-55159326 CCTGCTTCCCATGTGTGGCCCTG No data
Right 930774559 2:55159321-55159343 GCCCTGAGCCTACTGGGGAAGGG No data
930774552_930774562 1 Left 930774552 2:55159304-55159326 CCTGCTTCCCATGTGTGGCCCTG No data
Right 930774562 2:55159328-55159350 GCCTACTGGGGAAGGGATTGAGG No data
930774552_930774564 2 Left 930774552 2:55159304-55159326 CCTGCTTCCCATGTGTGGCCCTG No data
Right 930774564 2:55159329-55159351 CCTACTGGGGAAGGGATTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930774552 Original CRISPR CAGGGCCACACATGGGAAGC AGG (reversed) Intergenic
No off target data available for this crispr