ID: 930780807

View in Genome Browser
Species Human (GRCh38)
Location 2:55223672-55223694
Sequence AGGGACCGCTGAGCGGGTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 81}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930780807_930780824 19 Left 930780807 2:55223672-55223694 CCCGGACCCGCTCAGCGGTCCCT 0: 1
1: 0
2: 2
3: 4
4: 81
Right 930780824 2:55223714-55223736 AGGAGCCTCGGCAGGGGCCTAGG 0: 2
1: 0
2: 4
3: 49
4: 352
930780807_930780817 11 Left 930780807 2:55223672-55223694 CCCGGACCCGCTCAGCGGTCCCT 0: 1
1: 0
2: 2
3: 4
4: 81
Right 930780817 2:55223706-55223728 CCGCCCCCAGGAGCCTCGGCAGG 0: 2
1: 0
2: 0
3: 29
4: 273
930780807_930780818 12 Left 930780807 2:55223672-55223694 CCCGGACCCGCTCAGCGGTCCCT 0: 1
1: 0
2: 2
3: 4
4: 81
Right 930780818 2:55223707-55223729 CGCCCCCAGGAGCCTCGGCAGGG 0: 2
1: 0
2: 1
3: 13
4: 210
930780807_930780826 28 Left 930780807 2:55223672-55223694 CCCGGACCCGCTCAGCGGTCCCT 0: 1
1: 0
2: 2
3: 4
4: 81
Right 930780826 2:55223723-55223745 GGCAGGGGCCTAGGACGCCCCGG 0: 2
1: 0
2: 1
3: 21
4: 260
930780807_930780819 13 Left 930780807 2:55223672-55223694 CCCGGACCCGCTCAGCGGTCCCT 0: 1
1: 0
2: 2
3: 4
4: 81
Right 930780819 2:55223708-55223730 GCCCCCAGGAGCCTCGGCAGGGG 0: 2
1: 0
2: 3
3: 37
4: 338
930780807_930780815 7 Left 930780807 2:55223672-55223694 CCCGGACCCGCTCAGCGGTCCCT 0: 1
1: 0
2: 2
3: 4
4: 81
Right 930780815 2:55223702-55223724 GGCACCGCCCCCAGGAGCCTCGG 0: 2
1: 0
2: 2
3: 29
4: 292
930780807_930780814 -1 Left 930780807 2:55223672-55223694 CCCGGACCCGCTCAGCGGTCCCT 0: 1
1: 0
2: 2
3: 4
4: 81
Right 930780814 2:55223694-55223716 TGCTCACAGGCACCGCCCCCAGG 0: 1
1: 1
2: 2
3: 24
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930780807 Original CRISPR AGGGACCGCTGAGCGGGTCC GGG (reversed) Intronic
900123757 1:1060428-1060450 AGGGAGCGCCGAGGGGGGCCGGG + Intergenic
901790167 1:11649764-11649786 AAGGACTGGTGAGAGGGTCCTGG - Exonic
902684374 1:18066473-18066495 AGGGACAGCTGAGCTGGTCCAGG + Intergenic
903559339 1:24216195-24216217 GGGGACGGCTGAGCGGGGGCGGG + Intergenic
903605768 1:24574071-24574093 GGGGGCCGCTGTGTGGGTCCTGG - Intronic
905893967 1:41533444-41533466 AGGGACAGCAGAGCTGGCCCGGG - Intronic
916655957 1:166875856-166875878 AGGGCCTGCTGAGCAGGTGCGGG - Intronic
916768013 1:167880456-167880478 AGGGACCGCTGGGTGGGACCAGG + Intronic
917296284 1:173522780-173522802 AGGGACCTCTGTGCTGCTCCTGG + Intronic
919804505 1:201373129-201373151 AGGGACAGCTGGGAGGCTCCTGG + Intronic
919933581 1:202236996-202237018 AGGGCCAGCTGTGGGGGTCCTGG + Intronic
921676685 1:217983984-217984006 AGGTACTCCTGAGCTGGTCCTGG - Intergenic
1062902171 10:1154734-1154756 AGGGACCTCCAAGGGGGTCCCGG - Intergenic
1070742780 10:78913586-78913608 GGGGACCGCTGAGAGGGGCCTGG - Intergenic
1077200749 11:1306330-1306352 AGGGGCCGCTAATGGGGTCCTGG - Intronic
1083854731 11:65387067-65387089 TGGGATCGCTCAGCGGGGCCGGG - Exonic
1084408435 11:68992192-68992214 AGGGACCCCTGAGAGAGTGCAGG + Intergenic
1088818116 11:113435062-113435084 AGGGACACCTGAGCAGGCCCAGG - Intronic
1098297130 12:69015311-69015333 AGGGACTGTTGAGAGGGACCTGG + Intergenic
1102947526 12:117002444-117002466 AGGGAACGTTGAGGGGGTCAGGG + Intronic
1104880755 12:132068802-132068824 AGGGACTGCTGACCAGGCCCAGG - Intronic
1105828630 13:24144569-24144591 AGGCACCGCTGAGCAGCTCTTGG + Intronic
1108676258 13:52739818-52739840 GGGGACCGCTGGGCTGGCCCAGG - Intergenic
1119261762 14:73241918-73241940 GGGGACCCCTGAGTGGCTCCAGG + Intronic
1122826618 14:104373846-104373868 TAGGACCGCTGAGGTGGTCCAGG + Intergenic
1128323380 15:66707517-66707539 AGGGGCCGCTGAGCCGGGCAGGG - Intronic
1129540186 15:76342194-76342216 AGGGAGCGCTGAGCTGGGGCAGG - Exonic
1132185439 15:99798780-99798802 AGGGTCCCCTCAGAGGGTCCTGG - Intergenic
1132553064 16:561061-561083 AGGGACAGGTGAGTGGGGCCGGG + Intronic
1141477475 16:84283555-84283577 AGGGAGCGCCGAGCGGGTGAGGG + Intergenic
1147179312 17:38674510-38674532 GGTGCCCACTGAGCGGGTCCAGG + Exonic
1147437303 17:40425012-40425034 AGGGACAGCAGAGCTGGTCTGGG - Intergenic
1148110876 17:45144202-45144224 AGGGAGCGGGGAGCGGGGCCCGG + Intergenic
1151184140 17:72351083-72351105 AAGGAGCCCTGAGCGGGGCCAGG + Intergenic
1151874992 17:76862918-76862940 CGGGACCAGTGAGGGGGTCCAGG + Intergenic
1152617777 17:81345848-81345870 AGGGACCCCGCGGCGGGTCCTGG + Intergenic
1152929986 17:83104518-83104540 AGGGAGGGCTGATGGGGTCCTGG + Intergenic
1163719603 19:18892753-18892775 AAGGACCCCTGTGTGGGTCCAGG - Intronic
1164605895 19:29597930-29597952 AAGGAACTCTGAGCGGGTGCAGG - Intergenic
1166048950 19:40246838-40246860 TGGGAGGGCTGAGCTGGTCCAGG - Intronic
1166528433 19:43527315-43527337 GGGGACCGCCGAGCGGGACTGGG + Intronic
1166817822 19:45557410-45557432 AGGGACAGCTGTGAGGGGCCGGG + Intronic
1167474334 19:49691306-49691328 AGGGTCCGCTGATCGGATCCTGG - Exonic
1167506399 19:49873232-49873254 GGGGGCCGCTGAGCGCTTCCGGG - Exonic
1167669374 19:50841046-50841068 ACGGACCACTGAGAGGGACCTGG - Intergenic
1168089801 19:54075065-54075087 AGGGACCACCGAGCTGGGCCAGG + Exonic
927676394 2:25109730-25109752 AGGGACTGCTGAGTGGGTATAGG + Intronic
929898061 2:45978577-45978599 AGGGCCCACAGAGCGTGTCCTGG + Intronic
930780807 2:55223672-55223694 AGGGACCGCTGAGCGGGTCCGGG - Intronic
935285613 2:101561418-101561440 AGGGACCCCTGAAGGGGTGCTGG - Intergenic
944070020 2:195657647-195657669 AGTGACCGCTGGGCGGGTGGCGG + Intronic
1173691370 20:44963730-44963752 AGGGACAGATGAGAGGGTCAGGG + Intergenic
1176241727 20:64078652-64078674 AGGGACAGGTGACCAGGTCCAGG - Intronic
1178489155 21:33036963-33036985 AGGAACTGCTCAGTGGGTCCAGG - Intergenic
1179531052 21:42019946-42019968 AGGGACAGCAGAGATGGTCCGGG - Intergenic
1183784138 22:40019565-40019587 AGGGAGCTCTGGGCTGGTCCTGG + Intronic
1184711085 22:46249968-46249990 AGGGACGGCTGAGAGGGTCCGGG + Intronic
1185384614 22:50526121-50526143 AGGCACCGTGGAGCTGGTCCGGG - Exonic
950260054 3:11537024-11537046 AGGGTCCGCGGAGAGGGGCCTGG - Intronic
970546512 4:17135599-17135621 TGGGTCCCCTGAGTGGGTCCTGG - Intergenic
974329811 4:60463890-60463912 AGGGTGCCCTGAGCAGGTCCTGG + Intergenic
976897437 4:90128326-90128348 AGGAACCGCAGTGCGGGGCCGGG + Intronic
998334076 5:141355428-141355450 AGGTGCCGCTGCGCGGGTTCAGG - Exonic
1003151719 6:3558005-3558027 AGTGACTGCTTAGCGGGTACAGG + Intergenic
1007103598 6:39268434-39268456 AGTGACTGCTGAGCTGGGCCTGG - Intergenic
1019297407 7:285407-285429 GGGGTCCGCTGAGCGGGGCTCGG + Intergenic
1019723313 7:2586745-2586767 GGTGACAGCTGAGCGGGACCTGG + Intronic
1025047038 7:55700883-55700905 AGGGACCGCCAAGCGGGGCCAGG + Intergenic
1029906759 7:104100593-104100615 AGGAAGTGCTGAGCGGGTTCAGG - Intergenic
1031134694 7:117872889-117872911 CGGGTCCGCTGAGCGGTACCAGG + Intronic
1032398018 7:131604636-131604658 AGGGGCTGCTGAGAGGGTACTGG + Intergenic
1037886127 8:22597392-22597414 AGGTTCCTCTGAGCTGGTCCTGG + Intronic
1037987048 8:23296523-23296545 TGGGACCCCTGGGCTGGTCCTGG + Intergenic
1047262342 8:123274318-123274340 CGGGCCCGCCGAGCGGTTCCGGG - Exonic
1049625349 8:143617396-143617418 AGGGAGCGCTGTGGGGGTCTGGG - Intronic
1049697188 8:143990102-143990124 AGCGGCCGCCGAGCGGGTGCGGG + Exonic
1056555403 9:87683770-87683792 AGGGATCGGGGAGGGGGTCCTGG + Intronic
1056773401 9:89495788-89495810 AGGGAGGGATGGGCGGGTCCAGG - Intronic
1060407980 9:123382085-123382107 AGGCTGTGCTGAGCGGGTCCAGG + Exonic
1061415438 9:130444823-130444845 TGTGAACGCTGAGCGGCTCCAGG + Intergenic
1061559554 9:131393975-131393997 AGGGGGCGCTGCGCGGGCCCAGG + Intergenic
1062479632 9:136745332-136745354 AGGGGCCGCTGAGCTGATGCTGG + Intronic
1191846713 X:65552240-65552262 TGGGACCGCTCAGTGGGGCCGGG + Intergenic
1192166514 X:68830350-68830372 AGGGAACACAGAGCGGGACCCGG + Intronic
1198277771 X:135112717-135112739 AGGGAGCTATGAGCAGGTCCTGG - Intergenic
1199816009 X:151397360-151397382 AGGTAGCCCTGAGCGGGGCCTGG + Exonic
1200057589 X:153469868-153469890 AGGGACCACTGAGCCAGTCGCGG + Intronic
1200227822 X:154428846-154428868 AGTGACCGGTGAGCGGGCCGGGG + Exonic