ID: 930780996

View in Genome Browser
Species Human (GRCh38)
Location 2:55224739-55224761
Sequence CTGATGTTCTCATGGACACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 200}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930780996_930781000 9 Left 930780996 2:55224739-55224761 CCTTGTGTCCATGAGAACATCAG 0: 1
1: 0
2: 1
3: 18
4: 200
Right 930781000 2:55224771-55224793 TCAGGAAATTCAGCAAGACTTGG 0: 1
1: 1
2: 2
3: 16
4: 224
930780996_930780998 -9 Left 930780996 2:55224739-55224761 CCTTGTGTCCATGAGAACATCAG 0: 1
1: 0
2: 1
3: 18
4: 200
Right 930780998 2:55224753-55224775 GAACATCAGTGCTTTTCCTCAGG 0: 1
1: 1
2: 0
3: 12
4: 187
930780996_930781001 30 Left 930780996 2:55224739-55224761 CCTTGTGTCCATGAGAACATCAG 0: 1
1: 0
2: 1
3: 18
4: 200
Right 930781001 2:55224792-55224814 GGAGTAAAGCTCCGTCAAAGAGG 0: 1
1: 0
2: 0
3: 1
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930780996 Original CRISPR CTGATGTTCTCATGGACACA AGG (reversed) Intronic
904517734 1:31069666-31069688 CTCATGCTCTCAAGGTCACATGG - Intergenic
904615101 1:31745384-31745406 CTGCTGTTCTCCTGGCCTCAGGG - Intronic
904939246 1:34153444-34153466 CTCATCTGCACATGGACACATGG + Intronic
905558031 1:38902942-38902964 TTGATGTTTTCTTTGACACATGG - Intronic
905786156 1:40759360-40759382 CTGATGTTCTGGTGGAGACAAGG - Intronic
907189111 1:52633751-52633773 CTGATGTTCAGGTGGACACTCGG - Intronic
909849126 1:80437823-80437845 CTGATATTCTCATGGTTACTGGG + Intergenic
910059264 1:83068858-83068880 CTGCTGATCGCATGGAAACAAGG + Intergenic
913446270 1:118954034-118954056 CTAATCTTCACATGGACACTTGG + Intronic
915699812 1:157781180-157781202 CTGTTGTTCTCATGGAACCCAGG - Intergenic
917645621 1:177026058-177026080 CTGATGTCCTCAGGAACACAGGG + Intronic
917748908 1:178037274-178037296 CGTATGTTCACATGGAAACACGG + Intergenic
919536436 1:198793509-198793531 CTGATGTTCTCACTCCCACATGG + Intergenic
919998603 1:202777236-202777258 TTGCTGCTCTCATGGACAAAAGG - Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
921561169 1:216659888-216659910 CTGACACTCTCTTGGACACAGGG - Intronic
921589249 1:216984588-216984610 CAGATGTTTTTATGGACACCTGG - Intronic
922746674 1:228048167-228048189 CTGAGGTTCTCCTGGAGCCAGGG - Intronic
923105101 1:230848351-230848373 CTGATGATCTCATGAAGGCAGGG + Intronic
923252347 1:232189156-232189178 CTAATGTTCTCTTGGACCCAAGG + Intergenic
924161330 1:241235447-241235469 CTGATGTTGCCATGGAAACCAGG - Intronic
1065326074 10:24551858-24551880 CTGATGTGTTCACAGACACAAGG - Intergenic
1065523557 10:26594874-26594896 GTGTTTTTCACATGGACACAAGG - Intergenic
1066278235 10:33889445-33889467 CTGGTGTTCTCATGGTCTTAGGG + Intergenic
1066347307 10:34600503-34600525 CAGATATTCTGGTGGACACATGG - Intronic
1070279165 10:75036430-75036452 CTCATGTTAACATGCACACAGGG - Intergenic
1070706226 10:78640969-78640991 CTGACCCACTCATGGACACAGGG - Intergenic
1070766901 10:79061967-79061989 GTGCTGTTTTCAAGGACACACGG - Intergenic
1071967775 10:90870067-90870089 CTGATGTTGTATTGCACACAAGG + Intergenic
1073641195 10:105254260-105254282 CTGATGAAGTCATAGACACAGGG - Intronic
1074453425 10:113577675-113577697 CTCATTTGCTCATGGCCACATGG + Intronic
1074933667 10:118156606-118156628 CTCATGTTCTCATTGATAAATGG + Intergenic
1078131179 11:8615399-8615421 ATGATGTTGTCAAGGACAAAAGG + Exonic
1078829642 11:14967464-14967486 CTGATGATCTCAGGGTTACAAGG + Intronic
1079329965 11:19525227-19525249 CTGATTTGCCCAAGGACACATGG + Intronic
1079912056 11:26322941-26322963 CTTATGTCATCATGGACTCATGG + Intronic
1081026574 11:38021848-38021870 ATATTGTTCTCATGGCCACATGG + Intergenic
1081497598 11:43631154-43631176 CTGTTGGTTTCTTGGACACATGG + Intronic
1082199235 11:49343217-49343239 CTGATTGTCTCAAGGTCACATGG - Intergenic
1086656585 11:89364896-89364918 CTGATTGTCTCAAGGTCACATGG + Intronic
1088887283 11:114017779-114017801 TTGATGTTATCATGGAAGCATGG - Intergenic
1090129132 11:124121054-124121076 TTGCTGTTCTCATCCACACAAGG + Intronic
1091163632 11:133450086-133450108 CTTTTGTTCTTATGGTCACAAGG - Intronic
1091803272 12:3338524-3338546 CTTATGGGCTCATGGAGACAGGG + Intergenic
1092086585 12:5767938-5767960 CTGAGGTTCTCATGAACAAGTGG - Intronic
1093512372 12:19944655-19944677 CTGACATTCTCTTGGACATAGGG - Intergenic
1094331009 12:29293327-29293349 CTGATCTTCTCATGCACATTTGG - Exonic
1096010860 12:48213148-48213170 CTGATGTCCTGATGGAAACACGG - Intergenic
1106320384 13:28632147-28632169 CAGAGGTTCTCAAGGTCACATGG + Intergenic
1106788080 13:33127238-33127260 CTGATGATCTCCTGGACATAAGG - Intronic
1107155461 13:37161928-37161950 ATGATGTTCTGATGCATACAAGG - Intergenic
1107854422 13:44600895-44600917 TTGATGTTCTCTTGAACCCATGG + Intergenic
1108456239 13:50616870-50616892 GAGATGATCTCATGGAAACATGG - Intronic
1108829206 13:54455683-54455705 CTGATGTGAACATGGACACGTGG + Intergenic
1111510541 13:89256221-89256243 CTGAGTTTCTCACGGACTCAGGG + Intergenic
1111865387 13:93761933-93761955 CTGGTGTTCTATTGGACAGATGG - Intronic
1114297337 14:21341684-21341706 CTGATGCCAACATGGACACAGGG + Intronic
1115511103 14:34138739-34138761 AAGATGTTCTAATGGACACAAGG - Intronic
1118021596 14:61721778-61721800 CTCATTTCCTCATGGTCACATGG - Exonic
1119788763 14:77331021-77331043 CTAAGGTTTTCAGGGACACAGGG - Intronic
1119962514 14:78875856-78875878 CTATCGTTCTCATGCACACAAGG - Intronic
1120221892 14:81743770-81743792 CTGATGTCCCCATGGTAACAGGG + Intergenic
1124408374 15:29413213-29413235 GAGATGTTCTCATGTAAACAGGG - Intronic
1126807850 15:52370654-52370676 GTGATTTTCTCATAGTCACAGGG + Intronic
1129802432 15:78425407-78425429 CACATGTTCTCATGCACACGTGG - Intergenic
1130825204 15:87536977-87536999 TTCACGTTCTCATGGACACAAGG - Intergenic
1131781370 15:95863391-95863413 CTGATTTTCCCATGGAAGCAAGG + Intergenic
1132625700 16:890482-890504 CTGATGTCCTGATGGTCACACGG - Intronic
1132706831 16:1248090-1248112 CGAATGTTCACATGCACACACGG + Intergenic
1135868376 16:26126140-26126162 CTCATCTTCTCTTGGTCACATGG + Intronic
1140911805 16:79460987-79461009 CTGATGTACTTATAGGCACATGG + Intergenic
1143015214 17:3887944-3887966 CTGATGATCTTTTGGAGACAAGG - Intronic
1143410556 17:6705889-6705911 GTGATTTGCTCATGGACACACGG - Intronic
1143599241 17:7933070-7933092 CTGATGTTGCCATGAATACAGGG - Exonic
1144196041 17:12896304-12896326 CTCATGTTTCCATGGAGACAAGG - Intronic
1147359968 17:39924308-39924330 CTGGAGTTCTCAGGGAAACAAGG - Intronic
1148398614 17:47332610-47332632 ATGTTGTTCTCATAGAAACAGGG - Intronic
1148667372 17:49384648-49384670 CTGATGTCTTCATGGAGACTTGG - Intronic
1150665302 17:67129948-67129970 CTGCTGTCCACCTGGACACAAGG - Intronic
1151142849 17:72011661-72011683 CTGAAGATCTCATGGCCACTTGG + Intergenic
1152793534 17:82294831-82294853 CTGCTGTATTCATGGACACTTGG + Intergenic
1157235926 18:45965556-45965578 CCGATTTTCTCATGGGAACAAGG - Intronic
1158819273 18:61140309-61140331 CTCAGGTTCTGATGGAGACAGGG - Intergenic
1160113801 18:76058362-76058384 GTGATGTTCTCGTGGGAACAAGG + Intergenic
1161702248 19:5802022-5802044 CTGAGGTGCACAGGGACACACGG - Intergenic
1162497099 19:11029401-11029423 GTGATGTGGTCATGGCCACAGGG + Intronic
1167885670 19:52497942-52497964 ATGCTTTTCTCATGAACACATGG - Intronic
1167912784 19:52717621-52717643 ATGCTTTTCTCATGAACACATGG + Intronic
1167931755 19:52871772-52871794 ATGCTTTTCTCATGAACACATGG + Intronic
926622709 2:15061544-15061566 CTGATGTCATCAAGGTCACAGGG + Intergenic
927108545 2:19847906-19847928 CTGATGGTCTCACAGACACTTGG - Intergenic
930780996 2:55224739-55224761 CTGATGTTCTCATGGACACAAGG - Intronic
931134012 2:59376560-59376582 CAGATGTTTTCATCGATACAAGG - Intergenic
931750429 2:65325214-65325236 CTCATGTTCCCAGGAACACAAGG + Intronic
933221687 2:79697057-79697079 CTGGTTTTCTCAGGGTCACATGG + Intronic
934616330 2:95773480-95773502 CTGAAGTTTGCAAGGACACATGG + Intergenic
934644566 2:96051080-96051102 CTGAAGTTTGCAAGGACACATGG - Intergenic
934837981 2:97607170-97607192 CTGAAGTTTGCAAGGACACATGG - Intergenic
934991329 2:98923997-98924019 TTGCTCTTCTGATGGACACATGG - Intronic
937927322 2:127177169-127177191 TGGATGTGCTCATGGACACACGG - Intergenic
939999942 2:148957148-148957170 CTGAAGTTCTTTTGGAAACAAGG + Intronic
940840034 2:158569036-158569058 TTGAAGTTCTCATCCACACATGG + Intronic
941352643 2:164455374-164455396 CTTATCTTTTCATGGAGACAGGG - Intergenic
944787037 2:203082276-203082298 CTGATGTTTTCCTGAACACATGG - Intronic
944855853 2:203765808-203765830 ATAATGTTCTCAAGGACAAAAGG + Intergenic
945497206 2:210523570-210523592 CTCATGTCCTCATTGACAAATGG - Intronic
946094757 2:217263933-217263955 CAGATCTTCTCATGGCCACGGGG - Intergenic
946483530 2:220078952-220078974 CTGATGTTCTCACTGACAATAGG + Intergenic
947352569 2:229261661-229261683 CTCCTGCTCCCATGGACACAGGG + Intronic
948120351 2:235524684-235524706 CAGGTTTTCTCTTGGACACAGGG - Intronic
1173055822 20:39611711-39611733 GTGATGTTTTTATAGACACAGGG - Intergenic
1177595712 21:23239840-23239862 CTGATGGTCTCAGAGACATAGGG - Intergenic
1177940171 21:27400262-27400284 CTGCTGTTCACAAGGACCCAGGG - Intergenic
1181272581 22:21668193-21668215 CTGGGGTTCTCTTGGCCACAAGG - Intronic
1182436291 22:30332676-30332698 CTGATGTTCACAAGGCCTCATGG + Exonic
1182566105 22:31201094-31201116 TTGATGTTCCCTTGGGCACAGGG + Intronic
1182678407 22:32058828-32058850 CTGCTGTTCTCATGGGCCCTGGG + Intronic
1182752099 22:32649910-32649932 CTGATTTTCTCATTCCCACAAGG - Intronic
1183508808 22:38223344-38223366 ATGATGTTCCCACGGGCACAGGG + Intronic
1184710186 22:46245180-46245202 TTGATGTTCTCCCGGACACAAGG + Exonic
1185173680 22:49307363-49307385 CTGGTGTCCTGGTGGACACAGGG - Intergenic
949496533 3:4637570-4637592 CTGCTATTCTCAGTGACACAAGG - Intronic
952225279 3:31369128-31369150 GTGATGTTCTCAGGGATGCATGG + Intergenic
953317846 3:41945116-41945138 TTAATGTTCTGATGGAGACAGGG - Intronic
954133464 3:48571366-48571388 CTGATGTGACCATGAACACATGG + Intronic
955046590 3:55366834-55366856 CTGATGTTCTCAAGGACACTGGG + Intergenic
955491155 3:59484373-59484395 CTGGAGTTCTCCTGGGCACAAGG - Intergenic
957660593 3:83146792-83146814 CTGATGGTCTCATTGAAACTTGG + Intergenic
958153088 3:89717179-89717201 GTGATGTTCTCTTGGGCACTTGG + Intergenic
963044150 3:141090174-141090196 TGGACTTTCTCATGGACACATGG - Intronic
963717812 3:148823596-148823618 GTGGTGTGGTCATGGACACATGG - Intronic
964765510 3:160175152-160175174 CTGATGATCCCATGGAGATAGGG - Intergenic
964914574 3:161824508-161824530 TTGATGTTCATATGGACACCAGG + Intergenic
969687541 4:8684093-8684115 ATGATGTTCTCATTGACAGAAGG + Intergenic
970311126 4:14783576-14783598 CTGATGTTTTCCAGGTCACAGGG - Intergenic
973730071 4:53814731-53814753 CTGATCTTCTGTTGGGCACAAGG + Intronic
974668647 4:64999734-64999756 ACGAGGTTCACATGGACACATGG + Intergenic
975580889 4:75906187-75906209 CTCATCTCCTCATGGACCCAGGG - Intergenic
977862910 4:101987831-101987853 CTGATGTTGGTATGGACACCAGG + Intronic
979896308 4:126162222-126162244 CACATGTTCTCATTCACACATGG + Intergenic
981881321 4:149616678-149616700 TTGGTGTTTACATGGACACAGGG + Intergenic
983951891 4:173652447-173652469 CTGATGTTCTCCTGTAAACAAGG + Intergenic
984977944 4:185246387-185246409 CTAATGTTCACCAGGACACAGGG - Intronic
985654479 5:1122811-1122833 CTCATGTGCTGATGGACACGAGG + Intergenic
985872138 5:2565352-2565374 CTGATGTTCTCAAAGACTCATGG + Intergenic
985929987 5:3049601-3049623 CTGTTCTTCTCATGCACACTTGG - Intergenic
989692257 5:44158519-44158541 CTGCTGTTGTCAGGGACTCAGGG + Intergenic
993862791 5:93156799-93156821 CTCATTCTCTCATTGACACATGG + Intergenic
994368632 5:98945050-98945072 CAGCTGTTCCCATGGACCCAGGG + Intergenic
994499119 5:100551793-100551815 ATGATGTTTTCATGTTCACATGG + Intronic
995017370 5:107326185-107326207 CTGAAGTTCTGCTAGACACATGG + Intergenic
997211492 5:132079626-132079648 CTTGAGTTCTGATGGACACAAGG - Intergenic
998267181 5:140674862-140674884 CTGCTGTCCTCAGGGACAGAGGG + Intronic
998506365 5:142675432-142675454 GTGATGTGCTCATGGTCACCTGG + Intronic
999055581 5:148572368-148572390 CTGATGTGCCCAAGGTCACATGG + Intronic
999788783 5:154917757-154917779 CTGTAGTTCTCAAAGACACAAGG + Intronic
999934847 5:156475541-156475563 CTGAGGTTCTCTTGGAGACAGGG - Intronic
1000702627 5:164472491-164472513 CTGATGTTTATAAGGACACAAGG - Intergenic
1001551375 5:172604444-172604466 CTGATCTTCTCATGAAAACTTGG - Intergenic
1001833659 5:174811419-174811441 CTCATGTTCTCATGAACCAAAGG - Intergenic
1001883017 5:175261387-175261409 ATGATGTACTAGTGGACACAAGG - Intergenic
1002008680 5:176258437-176258459 CTGATGTTCCCTTGGAAACCTGG - Intronic
1002218042 5:177653814-177653836 CTGATGTTCCCTTGGAAACCTGG + Intergenic
1002319360 5:178365836-178365858 GTGATGGTCTCCTGGCCACATGG + Intronic
1002359253 5:178657475-178657497 CTGATGGACTTATGGACATAGGG + Intergenic
1004357064 6:14939115-14939137 CTTATGTTCATATGGACTCATGG + Intergenic
1005401429 6:25438495-25438517 TTGAAGTTATCATGGCCACAGGG - Intronic
1005437594 6:25831780-25831802 GTGAGGTTCACAGGGACACAAGG - Intronic
1007289550 6:40775100-40775122 CTGATGTTCTAATGCTTACATGG - Intergenic
1007852372 6:44816122-44816144 CTGATTTTCTCTTTGACTCATGG - Intronic
1007949686 6:45860220-45860242 CAGATGTTCCCATGAGCACAGGG - Intergenic
1008827856 6:55719900-55719922 TTCACGTTCTCATGGGCACATGG - Intergenic
1011121166 6:83954588-83954610 TTTATGTTCTTATGTACACAGGG + Intronic
1011482242 6:87806498-87806520 CTGAAATTCTCATGGAGGCAGGG + Intergenic
1012113517 6:95263695-95263717 CTGAGGTTCCTATGGGCACAGGG + Intergenic
1012891304 6:104900657-104900679 TTGATGCTCTCTTGCACACAAGG + Intergenic
1013309818 6:108882930-108882952 CTGAAGCTCAAATGGACACATGG + Intronic
1013666138 6:112350487-112350509 CTGACTTTCTCATGGGCAGATGG - Exonic
1013785894 6:113780125-113780147 TTAAAGTTCTCATGGAAACAGGG + Intergenic
1014268699 6:119312111-119312133 CTGCTGTTCTTGGGGACACAAGG + Intronic
1014659791 6:124155796-124155818 CTGATGTTTTCAAGGGTACAAGG + Intronic
1016212492 6:141555193-141555215 CTGATGTTCTATTGCATACAAGG + Intergenic
1017569988 6:155733760-155733782 CTTTTGTGCTCATGGATACAAGG - Intergenic
1018520513 6:164644843-164644865 CTGATGTTCTAACTGACACTTGG - Intergenic
1019086763 6:169485947-169485969 CAGATGAACACATGGACACATGG + Intronic
1021002093 7:15343905-15343927 CTCATTCTCTCATGTACACAAGG + Intronic
1024391108 7:48813529-48813551 CTGACTTTGTCATAGACACAGGG - Intergenic
1026685577 7:72506684-72506706 CTGGTCTTCTCAAGCACACATGG + Intergenic
1030707577 7:112710406-112710428 CTTATCTTCTCATGTACATATGG - Intergenic
1033686309 7:143644294-143644316 CTGAAGTCTCCATGGACACAGGG + Intronic
1033689429 7:143723021-143723043 CTGAAGTCTCCATGGACACAGGG - Intronic
1033698304 7:143813327-143813349 CTGAAGTCTCCATGGACACAGGG - Intergenic
1035254720 7:157618993-157619015 CTGATGTTCTCATGGGGATCAGG - Intronic
1035741203 8:1929856-1929878 CTGCTGTTCTCTTGGCCACAGGG + Intronic
1036023858 8:4880720-4880742 CTCATCTTATCATGGACACGTGG - Intronic
1041977492 8:63816781-63816803 CTGATCTTTTCCTTGACACATGG + Intergenic
1043123271 8:76358821-76358843 ATATTGATCTCATGGACACAGGG + Intergenic
1043975907 8:86584286-86584308 TTCCTGTTGTCATGGACACAGGG + Intronic
1047132292 8:122035006-122035028 TAGAGGTTTTCATGGACACACGG - Intergenic
1047543449 8:125792965-125792987 GTGCAGTGCTCATGGACACAAGG - Intergenic
1048879783 8:138862816-138862838 GTAATGTCCTCAAGGACACAAGG + Intronic
1051364245 9:16309818-16309840 CTGATGTTCAAATGGAAACTCGG + Intergenic
1053032459 9:34792833-34792855 CTGATGCTCATATGGACACAGGG - Intergenic
1053048334 9:34937940-34937962 CTGATTCTCACGTGGACACAGGG - Intergenic
1059821514 9:117978598-117978620 CTGAAGTTCTCATGAAAGCAAGG + Intergenic
1062745282 9:138208063-138208085 CTCATTTCCTCATGGACTCATGG - Intergenic
1185870238 X:3658630-3658652 CTCATGTGCTCATGGGAACACGG - Intronic
1187112677 X:16317623-16317645 CTAACATCCTCATGGACACAAGG + Intergenic
1188025802 X:25208062-25208084 CTGAAGTTCTGAAGGACACCAGG - Intergenic
1188330714 X:28867688-28867710 CCACTGTTCTGATGGACACATGG + Intronic
1190442434 X:50488519-50488541 CTGTTTTTCTCCTGGGCACACGG - Intergenic
1191684953 X:63879887-63879909 CTGATGTCTTGTTGGACACAGGG - Intergenic
1195156502 X:102128363-102128385 CTGAAGTTCTCAAGGTAACAAGG + Intergenic
1195405524 X:104508980-104509002 GTGATGTGCTTAAGGACACAGGG + Intergenic
1197606477 X:128591309-128591331 ATGATGAACACATGGACACAGGG - Intergenic
1197981969 X:132226798-132226820 CTGACGTTGTCATGGCAACAAGG - Intergenic
1198867970 X:141145754-141145776 GTTATTGTCTCATGGACACAAGG + Intergenic
1200764556 Y:7069539-7069561 CTGCTGTTCTCATGAAAAGAGGG - Intronic
1200793802 Y:7322461-7322483 CTCATGTGCTAATGGAAACATGG + Intergenic
1202044951 Y:20728588-20728610 CTGCTGTTCTCATGAAAAGAGGG - Intergenic