ID: 930787752

View in Genome Browser
Species Human (GRCh38)
Location 2:55286984-55287006
Sequence TACTCATCCCCTTTCAGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 124}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930787745_930787752 19 Left 930787745 2:55286942-55286964 CCAAAGTGCTGGGGTTACAGGCG 0: 1443
1: 126229
2: 272363
3: 223220
4: 153240
Right 930787752 2:55286984-55287006 TACTCATCCCCTTTCAGTTCTGG 0: 1
1: 0
2: 1
3: 3
4: 124
930787747_930787752 -8 Left 930787747 2:55286969-55286991 CCACCATGCCCGGCCTACTCATC 0: 1
1: 8
2: 104
3: 915
4: 5203
Right 930787752 2:55286984-55287006 TACTCATCCCCTTTCAGTTCTGG 0: 1
1: 0
2: 1
3: 3
4: 124
930787739_930787752 29 Left 930787739 2:55286932-55286954 CCTCGGCCTCCCAAAGTGCTGGG 0: 114360
1: 259489
2: 214307
3: 130302
4: 170463
Right 930787752 2:55286984-55287006 TACTCATCCCCTTTCAGTTCTGG 0: 1
1: 0
2: 1
3: 3
4: 124
930787744_930787752 20 Left 930787744 2:55286941-55286963 CCCAAAGTGCTGGGGTTACAGGC 0: 2920
1: 221507
2: 272433
3: 184695
4: 142229
Right 930787752 2:55286984-55287006 TACTCATCCCCTTTCAGTTCTGG 0: 1
1: 0
2: 1
3: 3
4: 124
930787742_930787752 23 Left 930787742 2:55286938-55286960 CCTCCCAAAGTGCTGGGGTTACA 0: 4078
1: 294830
2: 265780
3: 152940
4: 134736
Right 930787752 2:55286984-55287006 TACTCATCCCCTTTCAGTTCTGG 0: 1
1: 0
2: 1
3: 3
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930787752 Original CRISPR TACTCATCCCCTTTCAGTTC TGG Intergenic
908481813 1:64547864-64547886 AACACATCCCCTTTCACTTCTGG + Intronic
916015691 1:160748117-160748139 TACTCACCCCCTTTGGGTCCTGG - Intronic
916476610 1:165175357-165175379 TATTCATTCCCTTGCACTTCAGG - Intergenic
916830950 1:168490428-168490450 TCCTCATCCTCTTTCTATTCTGG + Intergenic
917135240 1:171782830-171782852 TACTTATCACGTTTCACTTCTGG - Intronic
918595906 1:186292882-186292904 TACTCCTGCCCATTCTGTTCAGG - Intergenic
919791813 1:201296127-201296149 GTCCCATCTCCTTTCAGTTCAGG + Intronic
922778129 1:228226855-228226877 AAATCATCCTCTTACAGTTCTGG - Intronic
923287822 1:232514030-232514052 AACTCATCCTCTTTCAGTTCTGG - Exonic
1065600604 10:27364060-27364082 TACTGTTCCCTTTTCACTTCTGG + Intergenic
1070162712 10:73875230-73875252 TACTTCACCCCTTTCATTTCTGG - Intergenic
1072910533 10:99497011-99497033 AATTCATCCTCTTACAGTTCTGG - Intergenic
1073807711 10:107117476-107117498 TACTCATGACCTCACAGTTCTGG - Intronic
1073951263 10:108812428-108812450 TACTCATCCCCTTTCTTCCCTGG - Intergenic
1075284653 10:121172816-121172838 CACTCATCCCTTTACAGTGCTGG + Intergenic
1080172627 11:29323979-29324001 AATTCATTCCCTTTCTGTTCAGG - Intergenic
1080187992 11:29513674-29513696 TATTTTTCCCCTTTCACTTCTGG + Intergenic
1080259346 11:30329456-30329478 GACTCAGCTCTTTTCAGTTCTGG - Intronic
1082566382 11:54683878-54683900 TCCCCATCCACTCTCAGTTCTGG - Intergenic
1083540541 11:63508954-63508976 TCCTCATCCTCTTTCTCTTCGGG + Exonic
1084492250 11:69485288-69485310 TTCTCATCCCCTCTCAGTCGAGG + Intergenic
1084858242 11:72002344-72002366 AAGTCATCCTCTTTCAGCTCTGG + Exonic
1086350411 11:85938196-85938218 AACTCATCCCCTCTTTGTTCTGG - Intergenic
1089185509 11:116612103-116612125 TACTCTTCCCCTCTCAGCCCTGG - Intergenic
1089434029 11:118447628-118447650 TCCTCATCCCTTTTAAGTTGAGG - Intronic
1091630553 12:2157337-2157359 TACTCTTCCCATTTCAGCTGAGG + Intronic
1091868946 12:3871170-3871192 TATTCTTCCCCTCTCATTTCTGG - Intronic
1092071589 12:5635915-5635937 AACTCATCCCTTCTCAGCTCAGG - Intronic
1095586388 12:43854354-43854376 TACTCATATCCTATCAGTTGTGG - Intronic
1095764460 12:45879352-45879374 TACTCACCCCCTTCCATTCCTGG + Intronic
1097040299 12:56152389-56152411 TGTTCATTGCCTTTCAGTTCCGG + Exonic
1101641939 12:106592548-106592570 TCCTGATGCCCTTCCAGTTCTGG + Intronic
1104731568 12:131108177-131108199 GCCTGAGCCCCTTTCAGTTCTGG + Intronic
1107568916 13:41635631-41635653 TACAGATCCCCTCCCAGTTCTGG - Intronic
1109192722 13:59344870-59344892 AACTATTCCCCTTTCAGATCAGG - Intergenic
1113148992 13:107241304-107241326 TCCACGGCCCCTTTCAGTTCAGG - Intronic
1113779360 13:112967218-112967240 CTCTCATTCCCTGTCAGTTCAGG - Intronic
1116168413 14:41364724-41364746 TTCTCAGCCCCCTTCAGTTAGGG - Intergenic
1119316103 14:73695907-73695929 TCCTCATCCCCTTTAATTACTGG - Exonic
1119748034 14:77058470-77058492 TGCTCATTCCCTTCCAGCTCAGG + Intergenic
1120827583 14:88969561-88969583 AACTTATTCTCTTTCAGTTCTGG - Intergenic
1121891882 14:97602284-97602306 TTCTCATCCCCTGTCTTTTCAGG - Intergenic
1127092476 15:55480642-55480664 AACTCATACCCTTTCAGGTAGGG + Intronic
1136669970 16:31847386-31847408 TAATCATAACTTTTCAGTTCTGG - Intergenic
1146227372 17:31078569-31078591 TACTCACTCCCTTTCTGTTTAGG + Intergenic
1151247787 17:72808441-72808463 AACTGATCCCCTTCCTGTTCAGG + Intronic
1152066183 17:78113634-78113656 TTCTCCTCCCCTTTGTGTTCTGG - Intronic
1159207278 18:65269629-65269651 TACTCATCCCCTTACTGTGTTGG + Intergenic
1159208181 18:65281190-65281212 TGCTCATGCTCTGTCAGTTCAGG - Intergenic
1161340551 19:3739650-3739672 CACACATCCTCTTACAGTTCTGG + Intronic
1161604613 19:5207761-5207783 TACTGGTCCCCTTCCAGTGCGGG + Intronic
1164533346 19:29064692-29064714 TTCTCATCCCATTCAAGTTCAGG + Intergenic
1165391848 19:35543478-35543500 TCCTCATACCCTTTGAGCTCTGG - Exonic
925530016 2:4849219-4849241 TACTCAACCCACTTCAGATCAGG - Intergenic
925852881 2:8099850-8099872 TTCTAAGTCCCTTTCAGTTCTGG + Intergenic
928666183 2:33552719-33552741 TACTAACACTCTTTCAGTTCTGG - Intronic
930787752 2:55286984-55287006 TACTCATCCCCTTTCAGTTCTGG + Intergenic
931862957 2:66376269-66376291 TTCTCATCCCCTCTCAATCCCGG - Intergenic
939964212 2:148594786-148594808 CACACCTCCCCTTGCAGTTCAGG + Intergenic
942130378 2:172872911-172872933 TACAAATCCCCTCTCACTTCAGG + Intronic
948038506 2:234879613-234879635 TTCTCATCCACTTGCAGCTCTGG + Intergenic
948915127 2:241030560-241030582 TCCTCATCCCCTGTGAGTCCAGG + Exonic
1168853959 20:995780-995802 TGCTCAGCCCCTTTCAGTCATGG - Intronic
1169087511 20:2836456-2836478 TCCTCATTCCCTCTCATTTCAGG + Intronic
1173073665 20:39795203-39795225 GACTCATCTCCTTCCATTTCAGG - Intergenic
1176376752 21:6090543-6090565 TACTGATTCCCTTACAGCTCTGG - Intergenic
1179746723 21:43447701-43447723 TACTGATTCCCTTACAGCTCTGG + Intergenic
1181837492 22:25622824-25622846 TTCTCTTCCCTATTCAGTTCTGG - Intronic
1183331242 22:37222910-37222932 TGCTCATCCCCTCTCAGCACGGG + Intergenic
1184873737 22:47258971-47258993 TACACATGACCTTTGAGTTCTGG + Intergenic
952816255 3:37450738-37450760 TCCTCTTCCCCTTTCTTTTCTGG - Intergenic
953374384 3:42416598-42416620 TAGTCAGCCCCCTTCAGGTCAGG - Intergenic
954975096 3:54685964-54685986 TACTGATCCCCTTTCAGGGCAGG - Intronic
956039213 3:65128568-65128590 TACTCATCCCCTTTCACAACAGG - Intergenic
958040778 3:88223286-88223308 AATTCATCACCATTCAGTTCTGG - Intergenic
959382282 3:105655528-105655550 TATTCATTCCTTTTCAATTCTGG - Exonic
961368711 3:126416775-126416797 TACTCACCTACTTTCAGCTCCGG - Intronic
962595842 3:136942740-136942762 TTCCCATCCCCTTTCTGTCCAGG + Intronic
962807446 3:138937536-138937558 TACACAGGCCTTTTCAGTTCTGG - Intergenic
963282807 3:143402708-143402730 TTCCCATCCCCTTTCCCTTCAGG + Intronic
963544905 3:146644267-146644289 TTCTGAGCCCCTTGCAGTTCTGG + Intergenic
967508018 3:190275876-190275898 TACTCTTTCCCTTTCACTCCAGG - Intergenic
970296934 4:14640436-14640458 TTCTCATCCTCTAGCAGTTCAGG - Intergenic
974486808 4:62516055-62516077 CATTATTCCCCTTTCAGTTCAGG - Intergenic
975516771 4:75256797-75256819 TGCTCATACCTTTTCAGTTATGG + Intergenic
980639629 4:135560339-135560361 TACTCAAACCTTTTCACTTCTGG + Intergenic
992488613 5:77219512-77219534 TTGTCATCACCTTCCAGTTCCGG - Intronic
995313089 5:110735610-110735632 TCCTCTTCCCCTTTAAGTGCAGG + Intronic
995327036 5:110902402-110902424 TACTCATCCTCTTGCAATCCAGG + Intergenic
995723472 5:115161965-115161987 TACTTAGCCCATTTCATTTCTGG + Intronic
996889649 5:128403026-128403048 TCCTCATACTCTTTCATTTCTGG + Intronic
998099904 5:139424091-139424113 AACTCATCACCCTTCACTTCTGG + Intronic
1002332577 5:178454855-178454877 AACTCATTCTCTCTCAGTTCTGG + Intronic
1005007064 6:21298148-21298170 TTCTTATTCCCTTTCAGTTATGG - Intergenic
1006334385 6:33412917-33412939 TCCTCATCCGCTTTCAGCCCAGG + Intronic
1007316318 6:40992218-40992240 TAATCATCCCTTCTCATTTCTGG + Intergenic
1009548351 6:65052187-65052209 TACCCAACCCCATTTAGTTCTGG + Intronic
1010506016 6:76660500-76660522 TGCTCTTCCCCTTGCAGTTGGGG - Intergenic
1013237005 6:108206009-108206031 TTCTCTTCCCATTTCAGTTTGGG + Intergenic
1013448552 6:110256103-110256125 TTCTCACCCCCTCTCATTTCTGG - Intronic
1013478796 6:110534550-110534572 AACTCATCTCTTATCAGTTCTGG - Intergenic
1013745373 6:113339374-113339396 TCAACATCCCCTTTCAGCTCAGG + Intergenic
1016675471 6:146761788-146761810 CATTCATTCCCTTACAGTTCTGG + Intronic
1016774532 6:147890801-147890823 TGTACATCCTCTTTCAGTTCTGG + Intergenic
1018099611 6:160425307-160425329 TACCCATACCCTTTCGTTTCTGG - Intronic
1028355876 7:89907096-89907118 TACTCATTCCCTGTTAGTTTAGG - Intergenic
1031150638 7:118049812-118049834 TACTCATTCCCTTGGAGATCTGG + Intergenic
1031202082 7:118700998-118701020 TTCTCATCCTCATTCAGATCAGG - Intergenic
1033542724 7:142372269-142372291 TACTCATCCCCTTGCTCTGCAGG + Intergenic
1034757864 7:153640107-153640129 TAGTCATCCCATTACAATTCGGG - Intergenic
1035917398 8:3639787-3639809 TACTCATCCTATTTTGGTTCAGG + Intronic
1039828207 8:41192751-41192773 TACCCATCCCCCTTCACTGCAGG + Intergenic
1042399244 8:68327051-68327073 TACTTATCCTCTTTCTGTTTTGG - Intronic
1045315459 8:101040182-101040204 AATTCATTCTCTTTCAGTTCTGG + Intergenic
1045658112 8:104407919-104407941 TACACAACCCTTTTCACTTCTGG + Intronic
1048300191 8:133245689-133245711 TATTTATTCCCTTTTAGTTCTGG - Intronic
1048810739 8:138283835-138283857 CACTCCTCACCTCTCAGTTCAGG - Intronic
1055065637 9:72115354-72115376 AACTCATTCCCTTTTAGTCCAGG - Intronic
1055158279 9:73092416-73092438 TACTCATCCCATGTAACTTCAGG + Intergenic
1187238750 X:17493598-17493620 TCCTCATTCACTTTCAATTCAGG - Intronic
1190343119 X:49313079-49313101 CTCTCGTGCCCTTTCAGTTCTGG - Intronic
1192133014 X:68570599-68570621 GTCTCTGCCCCTTTCAGTTCAGG - Intergenic
1193796316 X:85878858-85878880 AATACATCCCATTTCAGTTCAGG + Intronic
1195579402 X:106484237-106484259 TAGTCATCCACTTTCACTTTAGG + Intergenic
1196441180 X:115721462-115721484 TACTCATTCCCTTGCGGTTTGGG - Intergenic
1196444708 X:115839450-115839472 TACTCATTCCCTTGCGGTTTGGG - Intergenic
1196465837 X:115970527-115970549 TACTCATTCCCTTGCTGTTTGGG + Intergenic
1198665704 X:139020065-139020087 TACTCAACCCCCTTGAGATCTGG + Intronic
1199714812 X:150499870-150499892 TACTCATCTCTTTTCAATGCTGG - Intronic