ID: 930789799

View in Genome Browser
Species Human (GRCh38)
Location 2:55313407-55313429
Sequence TAGTTTTTGTAGCTTGATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 203}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930789796_930789799 23 Left 930789796 2:55313361-55313383 CCTGGCATCCATTCACGGTTTTC 0: 1
1: 0
2: 1
3: 5
4: 103
Right 930789799 2:55313407-55313429 TAGTTTTTGTAGCTTGATCAAGG 0: 1
1: 0
2: 0
3: 10
4: 203
930789798_930789799 -6 Left 930789798 2:55313390-55313412 CCTTAAAAGTCTGTGTATAGTTT 0: 1
1: 0
2: 4
3: 24
4: 300
Right 930789799 2:55313407-55313429 TAGTTTTTGTAGCTTGATCAAGG 0: 1
1: 0
2: 0
3: 10
4: 203
930789794_930789799 28 Left 930789794 2:55313356-55313378 CCGCGCCTGGCATCCATTCACGG 0: 1
1: 0
2: 0
3: 6
4: 95
Right 930789799 2:55313407-55313429 TAGTTTTTGTAGCTTGATCAAGG 0: 1
1: 0
2: 0
3: 10
4: 203
930789797_930789799 15 Left 930789797 2:55313369-55313391 CCATTCACGGTTTTCAAGAAACC 0: 1
1: 0
2: 2
3: 14
4: 94
Right 930789799 2:55313407-55313429 TAGTTTTTGTAGCTTGATCAAGG 0: 1
1: 0
2: 0
3: 10
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930789799 Original CRISPR TAGTTTTTGTAGCTTGATCA AGG Intronic
901344094 1:8523492-8523514 TGGTCTGTGTAGCTTGAACATGG - Intronic
901730470 1:11275410-11275432 TATTTTAAGTAGTTTGATCAGGG + Intronic
902420367 1:16274448-16274470 AAGTTTTCGTATCTTGATCTAGG + Intronic
903564814 1:24257136-24257158 AAGTTTTTGTTGCCTGATCTTGG + Intergenic
904052385 1:27647505-27647527 GAGTTTATGCAGCTTGTTCAAGG - Intergenic
904148157 1:28412483-28412505 TATTTTTTATTGCTTTATCAAGG + Intronic
904154675 1:28472967-28472989 AACTTTTTGTAACTTGATCTTGG - Intronic
904239675 1:29135576-29135598 GAGTTTAAGTAGCTTGTTCAAGG + Intergenic
905942087 1:41872050-41872072 AAGTTTTTATATCTTGATTAGGG - Intronic
907674364 1:56504910-56504932 TTGATTTTGTAGCTTGCTAATGG - Intronic
907674816 1:56508726-56508748 TGGGTTTTGCAGCTTTATCAGGG - Intronic
909810660 1:79928923-79928945 CAGTGTTTGCAGCTTCATCAGGG - Intergenic
912197437 1:107415081-107415103 TAGTCTTTGGAGCCTGATCAGGG + Intronic
913049246 1:115102236-115102258 TATTTTTTGTAGGTTTTTCATGG + Intergenic
915241696 1:154527075-154527097 TAGTTTTTGTATTTTTAGCATGG + Intronic
915770855 1:158421452-158421474 TTGTTTCTGTAGCTTTATCCTGG + Intergenic
915952721 1:160200272-160200294 TAGATTTTTGAGCTTGTTCAGGG + Intronic
916448664 1:164897460-164897482 TAGTTGCTGAAGCTTGATGATGG - Intronic
916921121 1:169468061-169468083 TAGTATGTGTGACTTGATCAGGG - Intronic
917056348 1:170986095-170986117 TAGTTCTTGCACCTTGATCATGG + Intronic
917321767 1:173789631-173789653 TAATTTTTGTTGCTTCATCAAGG - Intergenic
917909235 1:179624529-179624551 TAGTTCTAGTAGCTTTTTCATGG - Intronic
919254419 1:195103303-195103325 CAGTTTGAGTAGCTTGATGATGG + Intergenic
919324276 1:196086473-196086495 TTTTTTTTTTATCTTGATCATGG - Intergenic
919401339 1:197121208-197121230 TAGTTTGTTCAACTTGATCAAGG + Intronic
921017542 1:211206298-211206320 CAGTTTTTGTAACCTAATCATGG - Intergenic
921910191 1:220540093-220540115 TAGTTTTTGTAGGTTTATTAGGG + Intronic
921927827 1:220727165-220727187 TCTTTTTTGTGGCTTGTTCAGGG - Intergenic
922627058 1:227059104-227059126 TATCTTTTTTAGTTTGATCAAGG - Intronic
924747917 1:246855011-246855033 TAGTTTTTGTCCCATGATTAAGG - Intronic
1064099256 10:12449527-12449549 TAGGTATGTTAGCTTGATCATGG + Intronic
1065710987 10:28517673-28517695 TAATTTTTGTATGTTGATCCTGG + Intergenic
1066562441 10:36684860-36684882 TAGTTTTTGCATCTTTATCAGGG - Intergenic
1068423908 10:56831542-56831564 TAGTTTTTTTCTCTTGATCATGG - Intergenic
1072086775 10:92087518-92087540 AAGTTTTTCCAGCCTGATCAAGG + Intronic
1076454634 10:130581401-130581423 TACTTTTTGTAGATTCCTCAGGG + Intergenic
1078928827 11:15897766-15897788 CAGTTTTTATAACTTAATCATGG - Intergenic
1079207573 11:18430076-18430098 AATGTTTTGTATCTTGATCATGG - Intronic
1079502098 11:21112601-21112623 TAGTGTTTGTATTTTGCTCATGG + Intronic
1080666722 11:34342801-34342823 GAGGTTTGGTAGCTTGCTCACGG - Intronic
1081145198 11:39555089-39555111 TAGGTTTAGTACCTTGATTATGG - Intergenic
1086836831 11:91635383-91635405 GAGTTTATGTAACTTGCTCATGG + Intergenic
1088452432 11:109996619-109996641 TAATTTTGGTAGATTCATCAAGG - Intergenic
1089361559 11:117891675-117891697 TAATTTTTGTGGCTTCTTCAAGG - Intergenic
1093409838 12:18851546-18851568 AATATTTTGTATCTTGATCATGG + Intergenic
1094305247 12:29011628-29011650 TAATTTTTGTACATTGATGAAGG - Intergenic
1094602494 12:31922066-31922088 TAATTTTTGTAGTTTTATTAGGG - Intergenic
1095272801 12:40239852-40239874 TAGTTTATCTAGCTTGAGAATGG - Intronic
1095341538 12:41095124-41095146 TAGTCCTGGTAGCTTGATGATGG - Intergenic
1098709203 12:73733711-73733733 TAATTTTTGAATCTTGATCTTGG + Intergenic
1098854770 12:75639739-75639761 TAGTGTTAGTAGCTTTATTAAGG - Intergenic
1099260630 12:80376407-80376429 TGGTTTTTGTATCTTGATTCAGG + Intronic
1100694651 12:97078826-97078848 CAGTTTTTGTATCTGGAACATGG + Intergenic
1102831414 12:116004646-116004668 TCGTTTTTGTTGTTTAATCAAGG + Intronic
1103001158 12:117386389-117386411 AGGGTTTTGTGGCTTGATCAGGG + Intronic
1106307111 13:28522539-28522561 TAGTTTTCGTAGCTTAATTTGGG - Intergenic
1113283962 13:108825746-108825768 TTGTTTCTGTGCCTTGATCATGG - Intronic
1113504847 13:110808528-110808550 TGGTTTTTGCAGTTTGACCATGG - Intergenic
1114641524 14:24225579-24225601 TAATTTTTGAAGCTGGATGAAGG + Intronic
1115180062 14:30613607-30613629 TAGTTTTGGTGGGTTGGTCATGG + Intronic
1116632236 14:47350761-47350783 TAATTTTGGTAGCTAGATCCAGG + Intronic
1117034495 14:51714126-51714148 GAGTTTATGTAACTTGCTCAAGG - Intronic
1117558174 14:56907923-56907945 TAATTTTTTTAGCTTGCTCTTGG + Intergenic
1118617330 14:67583299-67583321 GAGTTTAAGTAACTTGATCAGGG + Intronic
1120260133 14:82173860-82173882 TATTCTTTGTGGCTTGATCAGGG + Intergenic
1120852460 14:89183889-89183911 GAGTTTAAGTAGCTTGCTCAGGG - Intronic
1124398394 15:29326667-29326689 TAGTTTTTGGATTTTGATTAGGG - Intronic
1125886320 15:43232334-43232356 TGTTTTTTCTAGCTGGATCATGG + Intergenic
1126658917 15:51012082-51012104 TAGTTGTTGAAGCTGGATAATGG - Intergenic
1128096810 15:64962734-64962756 TAATTTTTGAAGCTGGATGATGG + Intergenic
1128351981 15:66897012-66897034 CAGATTTTGTAGCTAGTTCATGG + Intergenic
1130675669 15:85949852-85949874 TCGTCTTTGTAACTTGATGAAGG - Intergenic
1135627609 16:24009846-24009868 TAGTTTTTGTATTTTCAGCAGGG - Intronic
1138849685 16:60612227-60612249 TAGTTTTCTTAGCTTGAGTAGGG - Intergenic
1140172520 16:72621471-72621493 TATGTTTTGTTTCTTGATCAAGG + Intergenic
1140952185 16:79829189-79829211 TCGTATTTGTACCTTGAACACGG - Intergenic
1142042453 16:87903262-87903284 TAGTTTTTGTAGTTTTAGTAGGG - Intronic
1149035259 17:52126819-52126841 TACTTTATGTAGCTTTATAAAGG + Intronic
1149812883 17:59694817-59694839 TAGTTTTTGTAGTTTTATATTGG + Exonic
1150309914 17:64119845-64119867 TAATTTTTGTACCTTAATCCTGG - Intronic
1150809833 17:68347633-68347655 CAGCTTTGGTAGCTTGATCTTGG - Intronic
1151042704 17:70882377-70882399 TAGGTTTTTTAGCTCAATCAGGG + Intergenic
1151963240 17:77418507-77418529 TAGTTTTTGTATTTTTAGCAGGG + Intronic
1155813718 18:30275299-30275321 AAGTTTTAGTAACTTGGTCAAGG + Intergenic
1157466487 18:47951242-47951264 TGGATTTTGTAGGCTGATCATGG - Intergenic
1157954596 18:52082696-52082718 TATTTTCTGTAGCTGGAGCATGG + Intergenic
1158349866 18:56554228-56554250 AAGGTTATGTAACTTGATCAAGG - Intergenic
1159154557 18:64566551-64566573 TAATTTTTGTATTTTTATCATGG + Intergenic
1164021086 19:21306055-21306077 TATTTTTTGTATTTTGTTCAAGG - Intronic
1165541611 19:36496764-36496786 TAGTTCTTGTAGTTTTAGCACGG + Intergenic
925426816 2:3756242-3756264 CAGTATTTGTAGGATGATCAGGG - Intronic
925967529 2:9079798-9079820 TTTTCTTTGTAGCTTGATGATGG - Intergenic
926110672 2:10181363-10181385 TAGTTTTTGCAGCCTTTTCAAGG + Intronic
926603293 2:14869975-14869997 CAGTTTTTGTTACTTGATTATGG - Intergenic
926657859 2:15428690-15428712 TAGATTTTCTTTCTTGATCATGG - Intronic
928072721 2:28233492-28233514 TAGTTTATTCAGCATGATCAGGG + Intronic
928614705 2:33025796-33025818 TAATTATTGAAGCTTGATGATGG + Intronic
929142910 2:38682003-38682025 TGGTTTTTTTAGCTTAATAAAGG + Intronic
930789799 2:55313407-55313429 TAGTTTTTGTAGCTTGATCAAGG + Intronic
932896428 2:75645251-75645273 TAGTTTTTGGAACTTCATCCAGG + Intergenic
933461361 2:82591308-82591330 TAATTTCTGTATCTTTATCATGG - Intergenic
935549002 2:104431797-104431819 AAGTTAATGTAGCTTGAACAAGG + Intergenic
935683588 2:105661634-105661656 TAATTTATGTAGCTTTATCTTGG + Intergenic
935844506 2:107150399-107150421 TAAGTATTGTAGCTTGCTCAGGG - Intergenic
935920917 2:108013217-108013239 TAGTTTTAGTACTTTGAACAGGG - Exonic
940377678 2:152974070-152974092 TAGTTTTTACTGCTTTATCAGGG - Intergenic
940515806 2:154682642-154682664 TAGGTTTTATGGCTTGGTCAGGG + Intergenic
941105491 2:161347170-161347192 TGTTCTTTGTTGCTTGATCAGGG + Intronic
941106070 2:161354646-161354668 TAGTTTTTGTGGGTTGATAGTGG + Intronic
941482458 2:166033740-166033762 TTGTTTTTTTATATTGATCAAGG - Intronic
941577109 2:167247095-167247117 TTGTATTTGTAGCTTTTTCAAGG - Exonic
943424864 2:187718784-187718806 TAGTATATGAAGCTAGATCAAGG - Intergenic
943576407 2:189636072-189636094 TATTTTTTGTCGCTTCATCTAGG + Intergenic
944293805 2:198039236-198039258 TAGTTTTTCTAGATTCAACATGG + Intronic
944517145 2:200523591-200523613 TATTTTTGGTAGCATGACCATGG + Intronic
944914696 2:204346396-204346418 TAGTTTATGTAGATTCAGCAAGG - Intergenic
945176326 2:207047464-207047486 GAGTTTAAGTAACTTGATCATGG + Intergenic
945460197 2:210098698-210098720 AAGATTAAGTAGCTTGATCAAGG + Intronic
945993597 2:216416945-216416967 AAGTTTTTGTCACTTGATCCTGG + Intronic
948959143 2:241317985-241318007 CAGTTTGTGTTGCTGGATCAAGG + Intronic
1168784686 20:528039-528061 CTGTTTTTGTAGCTCTATCAAGG - Exonic
1169355992 20:4906015-4906037 TATTTTTTTTCTCTTGATCAGGG + Intronic
1170278568 20:14620207-14620229 TAGATTTTGAAGCTTCAACATGG - Intronic
1171429842 20:25075991-25076013 TCTCTTTTGTAGCTTGAGCAGGG - Exonic
1172742140 20:37177329-37177351 TAGTATTGGTAGCTTGATTTTGG - Intronic
1173325305 20:42027411-42027433 TTGTTTTTGTAGCTTGTGAAAGG + Intergenic
1173395910 20:42679183-42679205 TAATTTTTGTAGCTTTGCCATGG - Intronic
1173677785 20:44852765-44852787 TAGTATCTGTATCTTGATCTTGG - Intergenic
1173901804 20:46595848-46595870 TAGTTTATGTAGGTTGGTCAAGG - Intronic
1174961653 20:55164437-55164459 TAGTTCTTGTAGCTGGATTCAGG + Intergenic
1184914561 22:47560530-47560552 TATTGTTTGTACCTAGATCAAGG + Intergenic
950542836 3:13622409-13622431 TAGCTGTTGTAGCATGCTCACGG - Intronic
951928204 3:27933559-27933581 GAGTTTAAGTAGCTTGCTCAAGG + Intergenic
953172300 3:40518294-40518316 CAGTTTTTGTAACTTAACCAAGG - Exonic
955556391 3:60142215-60142237 CAGTTTATGTAACTTGTTCAGGG - Intronic
960679199 3:120229308-120229330 TAGTTTTACTAGCTTTATTAAGG + Intronic
961316890 3:126043968-126043990 TAGTTTTTGTATTTTGATTGAGG - Intronic
961625394 3:128259001-128259023 TAGCTTTGGTAGCTTGTTCCAGG - Intronic
964673024 3:159247730-159247752 TAGTTTTTGTAGCTTGTTTGGGG + Intronic
966028516 3:175316386-175316408 TAGTTTCTGTACCCTGAGCAAGG + Intronic
967292189 3:187932094-187932116 AAGTTTAAGTAACTTGATCAAGG - Intergenic
967621658 3:191641893-191641915 TAGCTGTTGTAGCTTCACCAAGG + Intergenic
968400217 4:288409-288431 TAGTTTTTGTACATGGTTCAGGG + Intronic
969655078 4:8492166-8492188 GAGTTTTGGAAGCTTGATTATGG - Intronic
970122873 4:12776827-12776849 TAGGTTTTCTACTTTGATCATGG - Intergenic
972057691 4:34825541-34825563 TTGTTTTTGTAGATTAACCATGG + Intergenic
972794382 4:42400632-42400654 AGGTTTTAGTAGTTTGATCACGG - Intronic
972987311 4:44780252-44780274 TATTTTTTATAGCATGGTCAGGG - Intergenic
973718668 4:53702115-53702137 TATATTCTGTATCTTGATCAGGG + Intronic
975619120 4:76277774-76277796 GAATTTATGTAACTTGATCATGG + Intronic
976348175 4:84029409-84029431 TAATTTATGTTCCTTGATCAGGG + Intergenic
976951530 4:90837941-90837963 TAGTTTTTTTAGAATTATCAAGG + Intronic
979423679 4:120537970-120537992 TAGTTCATGTAGCTTTATTATGG - Intergenic
979842537 4:125462206-125462228 CTGTTTTTGTGGCTTGATTACGG - Intronic
980531565 4:134062844-134062866 TAGTTTTGGTAGAATGATCCAGG - Intergenic
981384593 4:144114262-144114284 GAGGTTTAGTAGCTTGCTCAGGG + Intronic
985468571 5:21519-21541 TAGTCTTTGTAGCTTCCTCCAGG + Intergenic
986272423 5:6245329-6245351 TAGTATTTGTGACTTGATCTGGG - Intergenic
986666086 5:10105601-10105623 TAGTTTTTTTAGATTTGTCATGG - Intergenic
986904407 5:12476495-12476517 TAGTTTGTGTAGGCTGATAAAGG - Intergenic
987752762 5:22063322-22063344 TAGTGTTTGTAGTTTCATCCTGG + Intronic
987918275 5:24244914-24244936 TAGTTTTTATAAAGTGATCAAGG + Intergenic
988748687 5:34172818-34172840 TAGTTTTTGTATCCTTATAATGG - Intergenic
990070984 5:51782538-51782560 TAATTTCTGTAGATTTATCAAGG + Intergenic
991292862 5:65049496-65049518 TTGTTTTTGTATCCTGAGCACGG + Intergenic
992454688 5:76905721-76905743 TAATTTTTGTAGCTAGTGCAAGG + Intronic
993736397 5:91481267-91481289 TAGTTTTTGCTACTTTATCAAGG - Intergenic
1000295534 5:159910298-159910320 GAGTTTATGTAGCTTGCCCAAGG + Intergenic
1000793667 5:165638041-165638063 GAGTTTAGGTAGCTTGACCAAGG + Intergenic
1001640888 5:173243489-173243511 ATGTTTTTGTATCTTGATTATGG - Intergenic
1001825115 5:174738420-174738442 GAGATTATGTAGCTTGCTCATGG + Intergenic
1003331180 6:5130027-5130049 TAGTTTTTGTAGCCAGAGCTGGG - Intronic
1003362805 6:5444801-5444823 TAATTTTTGAAGCTTGCTCGTGG + Intronic
1003975771 6:11343001-11343023 AATTTTCTGTAGCTTGATTAGGG + Intronic
1004928353 6:20437300-20437322 TAGTTTTTGTTTCTTGATCCGGG + Intronic
1005546257 6:26875914-26875936 TAGTTTTTGTATCCTTATAATGG - Intergenic
1008625874 6:53315972-53315994 TAGTTTTAGCAGCTTGCCCAAGG - Intronic
1008907047 6:56689968-56689990 TAGTGTTTGTACCTTTTTCAAGG - Intronic
1011818995 6:91228374-91228396 TGCTTTTTGTTGCTTCATCAGGG + Intergenic
1011999814 6:93639103-93639125 TAGTTTTTGTACCTGTCTCAAGG + Intergenic
1012122058 6:95381029-95381051 TTTTTTTTTTAGCTTGAACACGG - Intergenic
1012322764 6:97871376-97871398 TAGTCTTTGTAGATTGTTCTTGG - Intergenic
1012372495 6:98524668-98524690 TAGTTTTTATAAGTTTATCAGGG + Intergenic
1015314086 6:131797346-131797368 TTGTTTTCTTAGCTTCATCAAGG - Intergenic
1016227345 6:141755050-141755072 GAGTTTTGGTAGCTTGTCCAAGG + Intergenic
1016354115 6:143199406-143199428 TAGTTGTTGAAGCTGGATGATGG + Intronic
1018467670 6:164066063-164066085 CAGTTCTTGTAGCTTGGTTAGGG + Intergenic
1020473695 7:8569597-8569619 TAATTTTTGAAGCTGGATGATGG + Intronic
1024089903 7:45927691-45927713 TAGTTTTTGTAGTTTTATTGTGG + Intergenic
1024882343 7:54102432-54102454 TAGATTTTGCAGCTTTATGATGG - Intergenic
1027519363 7:79184971-79184993 TAAATTTTGTCACTTGATCATGG - Intronic
1027693477 7:81377594-81377616 TTGTTTTTCAAGCTTGATTATGG - Intergenic
1028830827 7:95324850-95324872 GAGATTCAGTAGCTTGATCATGG + Intergenic
1029047042 7:97640637-97640659 TAGTTCTTGTGGCTTGAAAATGG - Intergenic
1030456345 7:109779533-109779555 GAGTTTTTGTACCTGGATAATGG - Intergenic
1031457969 7:122007708-122007730 AAGTATCTGTAGCATGATCATGG + Intronic
1034684199 7:152955444-152955466 TAGGTTAATTAGCTTGATCATGG + Intergenic
1037619130 8:20547893-20547915 TAGGTTTTGTACCTTGATTGTGG + Intergenic
1038930762 8:32191249-32191271 TAGTTTTTGTATTTTTAGCAGGG + Intronic
1038951534 8:32420486-32420508 TAGTTTCTGTCACTTGATGATGG + Intronic
1041587960 8:59543779-59543801 TAGTTGTTGAAGCTGGATAATGG + Intergenic
1043386549 8:79754146-79754168 TTGTATTTTTAGCTTTATCAGGG - Intergenic
1044559098 8:93595271-93595293 TAACTTTTGTATCTTAATCAAGG - Intergenic
1045076932 8:98580366-98580388 TAGCTATTTTAGCTAGATCAGGG - Intronic
1046051512 8:109028500-109028522 TAGTTTTATTAGATTGATTAAGG + Intergenic
1046297093 8:112233812-112233834 TAGTTACTGTAGCTTCACCATGG - Intronic
1048534944 8:135284418-135284440 TAGCCTTTGTAGCTTAATAATGG - Intergenic
1051242415 9:15073291-15073313 TAGGTTTAGTAACTTTATCATGG + Intergenic
1053458558 9:38250791-38250813 GAGTTTTTGTGGCCTGTTCAAGG + Intergenic
1053520044 9:38768335-38768357 AAGCTTTTGTAGGTTGAGCAAGG - Intergenic
1059068699 9:111111557-111111579 TACTTTTTGCTGCTTCATCACGG - Intergenic
1061458449 9:130716415-130716437 TAATTTTTGCTGCTTCATCAAGG - Intronic
1188176779 X:27001108-27001130 TAGTTTATGAAGCGTGGTCATGG + Intergenic
1197443580 X:126520691-126520713 TTGTTTTTCTAGCTTTATTAGGG - Intergenic