ID: 930790179

View in Genome Browser
Species Human (GRCh38)
Location 2:55317343-55317365
Sequence ATTGTAACTGGGGGGAAAAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 296}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930790172_930790179 5 Left 930790172 2:55317315-55317337 CCAACTGTCCTTTCTGTTTTAAT 0: 2
1: 0
2: 3
3: 61
4: 555
Right 930790179 2:55317343-55317365 ATTGTAACTGGGGGGAAAAAAGG 0: 1
1: 0
2: 3
3: 30
4: 296
930790173_930790179 -3 Left 930790173 2:55317323-55317345 CCTTTCTGTTTTAATAACTGATT 0: 1
1: 0
2: 3
3: 43
4: 530
Right 930790179 2:55317343-55317365 ATTGTAACTGGGGGGAAAAAAGG 0: 1
1: 0
2: 3
3: 30
4: 296
930790171_930790179 14 Left 930790171 2:55317306-55317328 CCAAATCTTCCAACTGTCCTTTC 0: 1
1: 0
2: 2
3: 24
4: 315
Right 930790179 2:55317343-55317365 ATTGTAACTGGGGGGAAAAAAGG 0: 1
1: 0
2: 3
3: 30
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930790179 Original CRISPR ATTGTAACTGGGGGGAAAAA AGG Exonic
900835369 1:4999224-4999246 ATTGGAACAGGGAGGAAAGACGG - Intergenic
901573486 1:10181158-10181180 ATTGTCTGTGGAGGGAAAAAAGG - Exonic
903865253 1:26392978-26393000 ATGGTCACTGGGGGGCCAAAGGG + Intergenic
905316682 1:37086312-37086334 ATTGACACTGGGGAGAAAAGAGG - Intergenic
906627280 1:47335012-47335034 ATTGACACTGTGGGAAAAAAAGG + Intronic
907118984 1:51992129-51992151 AATGGAACTTGGGGGGAAAATGG - Intergenic
907336164 1:53701140-53701162 AGTGTAGCTGGGGGGTCAAATGG + Intronic
908877619 1:68695982-68696004 AATGTACCTGTGGGCAAAAAGGG - Intergenic
909296240 1:73952752-73952774 ATTGGTCCTGGGGGGAAGAAAGG + Intergenic
910591789 1:88933952-88933974 ATTATAACTGGAGGGAAGGAAGG + Intergenic
910787133 1:91012098-91012120 TTTGTCACTGGGGGGAAAAAAGG + Intronic
911234204 1:95392546-95392568 ACTGAAATTGGGAGGAAAAAAGG - Intergenic
913223530 1:116678744-116678766 ATTATAAGTGAGGGGAAAAGGGG - Intergenic
913289038 1:117255559-117255581 ATTTTATTTGAGGGGAAAAATGG - Intergenic
913564147 1:120054814-120054836 TTTGTAACTGGGAAGAAGAATGG - Intronic
913633977 1:120738751-120738773 TTTGTAACTGGGAAGAAGAATGG + Intergenic
914284736 1:146214162-146214184 TTTGTAACTGGGAAGAAGAATGG - Intronic
914545767 1:148664901-148664923 TTTGTAACTGGGAAGAAGAATGG - Intronic
914620798 1:149405765-149405787 TTTGTAACTGGGAAGAAGAATGG + Intergenic
915191956 1:154158546-154158568 CTTCTGACTGGGTGGAAAAAAGG - Intronic
915253122 1:154604676-154604698 ATTATAAGGGGTGGGAAAAAGGG - Intronic
915730536 1:158050644-158050666 ATGGGAACTGGGGAGGAAAATGG + Intronic
917721152 1:177787732-177787754 ATTGGATTTGGTGGGAAAAAGGG + Intergenic
918943885 1:191035563-191035585 ATGCTGACTGGGGGTAAAAATGG + Intergenic
921085919 1:211792491-211792513 ATAGTAACTGGGAGGAAAGCAGG - Intronic
923228176 1:231958812-231958834 CTTGTTTCTGGGGGAAAAAAAGG - Intronic
923666532 1:236003245-236003267 ACTGTAACTGGGCAGGAAAAGGG - Intronic
924202748 1:241676708-241676730 AATGTAACTGGAGGAAAAAATGG + Intronic
924723844 1:246648803-246648825 AGTGAACTTGGGGGGAAAAATGG - Intronic
1062872645 10:919485-919507 AGAATAAATGGGGGGAAAAAAGG + Intronic
1063048762 10:2422067-2422089 ATTATATGTGGGGGGAAATAGGG - Intergenic
1064230512 10:13526070-13526092 TTTGCAATTAGGGGGAAAAAAGG - Intronic
1065274294 10:24069622-24069644 ATTAAAACTGGTGGGAAAATTGG - Intronic
1065411877 10:25438237-25438259 ATTGTCACTGTGGGGAAAGGAGG + Intronic
1065747806 10:28857985-28858007 ATTGTACCTGGAGGGAAGAAAGG - Intronic
1067893222 10:50153326-50153348 ATTGGTAAAGGGGGGAAAAACGG + Intergenic
1068480196 10:57579851-57579873 ATTCTAACTGGAGGCAAAATAGG + Intergenic
1069644045 10:69979194-69979216 ATTGTTACTAGGGGCAAAGAAGG + Intergenic
1071148733 10:82607513-82607535 ATTGTCAGAGTGGGGAAAAAAGG - Intronic
1071536581 10:86437821-86437843 ATAGTAAGTGGGAGCAAAAAGGG - Intronic
1072604923 10:96972795-96972817 ATCGAAACTGGGGGAAAAATAGG - Intronic
1072704014 10:97666985-97667007 TTTCTAACTGGGGGAGAAAATGG + Intronic
1073576710 10:104631963-104631985 AATACAACTGGGGGGAAAAGTGG - Intergenic
1078577026 11:12511282-12511304 GGTGTAACTGGGGGGAAAATGGG + Intronic
1078889350 11:15540007-15540029 ATGGGAACTGGGGCAAAAAAAGG + Intergenic
1079187881 11:18253751-18253773 CTTGCAACTGGGGAGAAAGAGGG + Intergenic
1079352191 11:19701151-19701173 TTTCTAAGTGGGGTGAAAAAGGG - Intronic
1079869259 11:25776033-25776055 ATTGCAACTAGAGGGAAAATGGG + Intergenic
1083136370 11:60680695-60680717 ATAGTACCTGTGGGAAAAAACGG + Intergenic
1083506087 11:63158861-63158883 ATAGTTAATGGGGGGAAAAAAGG - Intronic
1085586176 11:77708781-77708803 TTTGTAACAGGGGAGGAAAAAGG - Intronic
1086423727 11:86663651-86663673 ATAGTGAGAGGGGGGAAAAAAGG - Intronic
1089096003 11:115920615-115920637 ATTGGAAATGGGGGGAAATAAGG - Intergenic
1090735527 11:129609461-129609483 ATGGAAACTGGTGGGCAAAAGGG + Intergenic
1091922203 12:4314119-4314141 ATTGTAACTGGAGGGCCAAGAGG + Intergenic
1094146017 12:27229193-27229215 TTTGAAACTCGAGGGAAAAAAGG - Intergenic
1095773258 12:45986085-45986107 AATATAACTTGGGGGAAAAAAGG - Intronic
1097157549 12:57023844-57023866 AATGTAACTCTGAGGAAAAAGGG - Intronic
1097493910 12:60304716-60304738 ATTTTAACTGGTTGGAAACATGG - Intergenic
1098080172 12:66775812-66775834 GGTGTTACTAGGGGGAAAAATGG + Intronic
1099568533 12:84283478-84283500 AGTCTAACTTGGGGGAAGAATGG + Intergenic
1099592581 12:84613328-84613350 ATTCTAACTGGTGTGAACAAGGG + Intergenic
1102262389 12:111451705-111451727 ATTGCAACGGGGAGGACAAAGGG - Intergenic
1102622377 12:114206440-114206462 GTTGTGATTGGTGGGAAAAATGG - Intergenic
1103042061 12:117703910-117703932 AAAGAAACTGGGGAGAAAAAGGG + Intronic
1103129660 12:118456609-118456631 AGACTAACTGTGGGGAAAAAGGG - Intergenic
1103542926 12:121678859-121678881 ATTGGAACTGAGGTGATAAAAGG - Intergenic
1104040125 12:125124387-125124409 ATTGTATCTTGGGGGACCAAAGG - Intronic
1104507434 12:129345586-129345608 TTTGTAAGTGGGAGGGAAAATGG + Intronic
1105059085 12:133131073-133131095 ATCCCAGCTGGGGGGAAAAATGG - Intronic
1106642868 13:31604106-31604128 ACTGCTACTGGGGGAAAAAAGGG + Intergenic
1106951664 13:34891325-34891347 ATTTTCACTGGAAGGAAAAAAGG - Intergenic
1107729620 13:43335249-43335271 ATTGTACCTGGGGAGAATCATGG - Intronic
1107758708 13:43652928-43652950 ATTGTAAAGGGGAGGAGAAAAGG + Intronic
1109159583 13:58955926-58955948 ATTATTTCTGGAGGGAAAAAGGG + Intergenic
1109443119 13:62400171-62400193 TTTGTAAGTGGGAGGGAAAATGG + Intergenic
1110193592 13:72759886-72759908 AATGCAAATGGGGGGAAATAAGG + Intronic
1110805155 13:79745600-79745622 ATTGTAACTGGGTGAGAAGAGGG - Intergenic
1112244624 13:97720413-97720435 ATGGGAACTGGGGAGGAAAAGGG - Intergenic
1113471580 13:110550436-110550458 ATTGCAACTAGGGGGAAGGAAGG + Intronic
1115256025 14:31403072-31403094 ATTTTAAAAGGGGGGTAAAAAGG + Intronic
1115406842 14:33026887-33026909 AATGTAACAGGGGGAAAAAAGGG - Intronic
1115429750 14:33302449-33302471 ATTGTAACATGGGTAAAAAACGG + Intronic
1116268528 14:42728510-42728532 ATTGTAACTGGGATGCAAACTGG + Intergenic
1117527254 14:56621238-56621260 ATTGCACTTAGGGGGAAAAAAGG + Intronic
1120800914 14:88687302-88687324 TTTGTAACTGGAGGAAAAGATGG - Exonic
1125187152 15:36944165-36944187 AATGTAACTGGGGGTAACCAGGG - Intronic
1125372694 15:38995466-38995488 CTTGGAACTGGGGGTGAAAATGG - Intergenic
1127894078 15:63279353-63279375 AATCTAACTGGGGAAAAAAAAGG - Intronic
1128931586 15:71709313-71709335 AATGTAAGATGGGGGAAAAAAGG + Intronic
1129957955 15:79656401-79656423 AATTTAACTGGAGAGAAAAATGG - Intergenic
1130930099 15:88419814-88419836 ATTGTACCCTGGGGAAAAAAAGG + Intergenic
1131366903 15:91849257-91849279 ATTGTCACTGGGATGGAAAATGG - Intergenic
1131616986 15:94026701-94026723 ATTGTGACTGGTGGTAAAGATGG + Intergenic
1133429224 16:5722117-5722139 ATTGTAACTGTGGGAAAGACAGG - Intergenic
1133439128 16:5805916-5805938 AGTGGATCTGGGGGGACAAATGG + Intergenic
1134333071 16:13268149-13268171 ATAGACACTGGGGGTAAAAATGG + Intergenic
1134356624 16:13488188-13488210 ATTTAATCTGGGGGGAAGAATGG - Intergenic
1138366416 16:56481761-56481783 GTTCTAAGTTGGGGGAAAAAAGG + Intronic
1139231027 16:65282453-65282475 ATTTTAACTTGAGGGAATAATGG + Intergenic
1140247465 16:73264157-73264179 ACTCTATCTGCGGGGAAAAAAGG + Intergenic
1140399938 16:74663416-74663438 AGTGCTACTGGGGGGAAGAACGG + Intronic
1140950186 16:79809541-79809563 ATTATAACTGCTGGGAAGAATGG - Intergenic
1141420648 16:83913245-83913267 ATTGTTACCCGGGGGAAACATGG - Intronic
1143344062 17:6236963-6236985 AAAATAACTTGGGGGAAAAAAGG - Intergenic
1144191938 17:12854386-12854408 ATTGTCAAAGGGGGGAAAAATGG - Intronic
1145290762 17:21543940-21543962 CTTGTTACTGGGGGCAAAATGGG + Intronic
1146087437 17:29842969-29842991 ATAGAAAAAGGGGGGAAAAAGGG - Intronic
1149877894 17:60256503-60256525 AATGTTAATGGGGGAAAAAATGG + Intronic
1150959621 17:69899564-69899586 AGTGAAAATGGGGGAAAAAAGGG + Intergenic
1151178059 17:72305301-72305323 ATTTTGGATGGGGGGAAAAAGGG + Intergenic
1153682437 18:7513279-7513301 TTTGTAGCTGGGGGGAATGATGG - Intergenic
1155280520 18:24234983-24235005 ATAGTAAGTGGAGGGAACAAGGG + Intronic
1155418548 18:25628397-25628419 AGGGTAACTGTGGGGAAACAAGG + Intergenic
1156145306 18:34168432-34168454 ATAGTTTCAGGGGGGAAAAAAGG + Intronic
1157271349 18:46278764-46278786 ATATTTACTGGGGGGTAAAATGG - Intergenic
1157706509 18:49812522-49812544 AGTGTAATTGGGGAGAAAAGGGG - Intronic
1157864792 18:51172250-51172272 ATTGGAATTGGGAGGGAAAATGG - Intergenic
1158199577 18:54924880-54924902 ATTGGAACAGGGGGGAACAGAGG - Intronic
1158307465 18:56122243-56122265 AGTTTAACTGGTGGAAAAAAAGG - Intergenic
1160231348 18:77051975-77051997 ATTGGAACAAGTGGGAAAAAAGG + Intronic
1161233626 19:3187544-3187566 ATCGTAACTCTGGGGCAAAATGG - Intronic
1162486384 19:10962877-10962899 AATGTAGCTGAGGGGAACAATGG - Intronic
1164744338 19:30599979-30600001 AGTGTCACTGGGGGAAAAAGTGG + Intronic
1165593868 19:36994957-36994979 ATTGTAACCAGTGAGAAAAAAGG - Intronic
1165641159 19:37388205-37388227 AATTTAACTGGGGGGAAGGAGGG - Intronic
1167452561 19:49580733-49580755 ATTGAAACTGGTGGGAATATGGG + Intronic
1168571795 19:57476740-57476762 ATTGTAACTGGGTAGGAATATGG - Intronic
925532329 2:4877728-4877750 TCAGCAACTGGGGGGAAAAAGGG - Intergenic
925711118 2:6741300-6741322 ATTGTAACAGGAAGTAAAAAGGG + Intergenic
926951320 2:18246618-18246640 AATATGACTTGGGGGAAAAAAGG - Intronic
926983249 2:18593917-18593939 TTTGTTTCTTGGGGGAAAAAAGG - Intergenic
928975542 2:37083054-37083076 ATTGTAACTGGAGAAAAACATGG - Intronic
929123696 2:38503913-38503935 AATGTACTTGGGGGGAAACATGG - Intergenic
929663763 2:43817016-43817038 ATGATGACTGGGGAGAAAAATGG + Intronic
930363742 2:50412762-50412784 ATTGTAGATGTGTGGAAAAAAGG - Intronic
930514200 2:52385072-52385094 ATTATAACTTTGGGGAAAAGGGG - Intergenic
930790179 2:55317343-55317365 ATTGTAACTGGGGGGAAAAAAGG + Exonic
931020638 2:58041062-58041084 ATGTTAACTGGGGGGGAAAAAGG + Intronic
933406854 2:81871577-81871599 ATTTGAAATAGGGGGAAAAATGG - Intergenic
933563288 2:83916536-83916558 ATTGTTACTAGAGGAAAAAAAGG - Intergenic
935103708 2:100020302-100020324 AGTGTCACAGGAGGGAAAAATGG - Intronic
937437380 2:121891705-121891727 ATTGTAACCAGGGGGATAGAAGG + Intergenic
937829742 2:126406400-126406422 ATGGTATCTCAGGGGAAAAAGGG - Intergenic
940986366 2:160055999-160056021 ATGGTGAATGGGGGGAAGAATGG - Intronic
941358573 2:164523061-164523083 ACAGTAAGTGGGGGGAAACAGGG + Intronic
941561828 2:167056220-167056242 AAAGTAACTGGGGGGAAAATAGG + Intronic
943474400 2:188336802-188336824 AGTGTAGCTGGTGGGAAAAGTGG + Intronic
943815512 2:192249372-192249394 ATTGTAAGTGGGGGGTGACAAGG - Intergenic
944947791 2:204710323-204710345 ATTCTGAATGGAGGGAAAAAAGG + Intronic
945936845 2:215911235-215911257 CTTTAAACTGGGGGAAAAAAGGG - Intergenic
946918932 2:224558006-224558028 ATTTTAACAGGGGGAAAAAAAGG + Intronic
947769937 2:232662501-232662523 ACTGAAACTGGGGGAAATAAAGG + Intronic
1169806845 20:9568289-9568311 ATTGTAGATGGGGTGAGAAATGG + Intronic
1170024118 20:11870164-11870186 CTTGAGACTGGGGGGAAAGAGGG + Intergenic
1170296180 20:14828900-14828922 ATTGTAGTTGTGGGCAAAAAGGG - Intronic
1171516947 20:25745808-25745830 AGTGTGGCTGGGGTGAAAAATGG + Intergenic
1172584798 20:36075477-36075499 AATGTTCTTGGGGGGAAAAATGG - Intergenic
1174223443 20:48976421-48976443 ATTAGAAAAGGGGGGAAAAAAGG - Intronic
1174776128 20:53344624-53344646 TTTATAAATGAGGGGAAAAATGG + Intronic
1175064576 20:56273979-56274001 ACTGAAGCTTGGGGGAAAAAAGG - Intergenic
1176943410 21:14951145-14951167 ACTAAATCTGGGGGGAAAAAAGG + Intergenic
1177023308 21:15890571-15890593 TTTGTAAAGGGGGAGAAAAAAGG - Intergenic
1177357094 21:20022299-20022321 ATTGTAACTCAAGGGGAAAAAGG + Intergenic
1181119339 22:20655099-20655121 ATGGTAACTGGGAGGGAAAGGGG - Intergenic
1182174055 22:28264894-28264916 ATTGTCTCTGGGGGAAAATAAGG - Intronic
949411312 3:3767614-3767636 ATTGTTACTGGGGACAAAATAGG - Intronic
953390958 3:42533507-42533529 ATTGTAAGTTGGGGGAAATAAGG - Intronic
953400083 3:42606241-42606263 ATGGGAACTGGGGGGGACAAGGG - Intronic
954731017 3:52661998-52662020 TTGGTAACTGGGAGGATAAAAGG - Intronic
956449596 3:69360206-69360228 CTTGAAACTAGGTGGAAAAATGG - Intronic
956693293 3:71897645-71897667 TTTGTAGCTGGGGAGAAGAAGGG - Intergenic
956947961 3:74245209-74245231 CTTGTAAGTGGGAGGAGAAAAGG + Intergenic
956996865 3:74836202-74836224 AATCTGACTCGGGGGAAAAAAGG - Intergenic
957460166 3:80507326-80507348 ATTGTAACTGAAGCCAAAAAGGG + Intergenic
959221561 3:103527482-103527504 ATTTTAATTAGGGGTAAAAATGG - Intergenic
959521030 3:107323111-107323133 GTGGTGACTGGAGGGAAAAATGG - Intergenic
960022456 3:112970341-112970363 TTTCTTCCTGGGGGGAAAAAGGG + Intronic
960903186 3:122572451-122572473 ATTGTAAATGGGAGGAAAAAGGG + Exonic
961630171 3:128291770-128291792 ATTAAAGCTAGGGGGAAAAAAGG - Intronic
961961181 3:130856958-130856980 ATTGTAACTTTGGGCACAAATGG + Intronic
962412010 3:135149397-135149419 ATTGTATATGGGGGCAAAAGGGG + Intronic
962835063 3:139182654-139182676 ATTGAGACTGAGAGGAAAAAAGG - Intronic
963028619 3:140943633-140943655 ATTTTAATTTGGGTGAAAAATGG + Intronic
964603017 3:158524051-158524073 ATTGTAACAGAGGTGAAACATGG - Intronic
965334009 3:167412632-167412654 TGAGTAACTGGGGGGAAAAGTGG - Intergenic
966440379 3:179938269-179938291 ATTGAACCTAGTGGGAAAAAGGG - Intronic
967110624 3:186290329-186290351 ATTGTCACTGGAGGAAAACATGG + Intronic
967215379 3:187205127-187205149 ATTGTAAATGGAAGGAGAAAAGG - Intergenic
967490339 3:190083511-190083533 CTTTTAACTGGGGAGAAATAAGG + Intronic
968785769 4:2621278-2621300 ATTGTAAGTGTGGCGAAGAAGGG + Intronic
969215399 4:5718197-5718219 GTTGTTCCTGGGGGGAAAACAGG + Intronic
969840161 4:9875720-9875742 TTTGTCACTGGGGGGAAAAGGGG - Intronic
971675573 4:29624103-29624125 ATTGTTACTTGAGGGAAGAAAGG - Intergenic
972386373 4:38570325-38570347 ATTGTTAGTGGGAGGAAGAAAGG - Intergenic
972609521 4:40643935-40643957 ATTGTGCCTGTGGGGAAAAAGGG + Intergenic
972850530 4:43044196-43044218 AATGGAACTGGGGAGAATAAAGG - Intergenic
972938919 4:44172908-44172930 ACTGGAGCTGGAGGGAAAAAAGG - Intergenic
972994173 4:44859544-44859566 ATTGTAAATGTAAGGAAAAAAGG + Intergenic
973805426 4:54521515-54521537 ATAATAAATGGGGGGAAAATGGG + Intergenic
974067178 4:57089506-57089528 GTCATAGCTGGGGGGAAAAATGG - Intronic
974374582 4:61060273-61060295 ATTGTAGCTGGAGGTAGAAATGG + Intergenic
975168278 4:71202662-71202684 ATTAAAACTGGGGAGGAAAATGG - Intronic
975841032 4:78474410-78474432 ATTGGAACTTGGGGGAAAAAAGG + Intronic
977089715 4:92655062-92655084 ATTGTAAGTGGTGAGAAATAGGG + Intronic
977381238 4:96276763-96276785 ATTGTTGTTGGGGGGCAAAATGG + Intergenic
977551345 4:98447113-98447135 TTCTTAAGTGGGGGGAAAAAAGG - Intergenic
977667237 4:99655142-99655164 AGTGTAACTTTGGGGAAAGAGGG - Intergenic
978459491 4:108935315-108935337 ATGGCAACTGGGGGTAAAGAAGG + Intronic
979155329 4:117380417-117380439 ATTGTCAGAGGGGGCAAAAAAGG + Intergenic
979996997 4:127443340-127443362 ATAGTAACTGAGGAGACAAAAGG - Intergenic
980017253 4:127664488-127664510 TTTAGAACTGGAGGGAAAAATGG - Intronic
980960952 4:139474340-139474362 GTTGTAACTTGGGGGAAAATAGG + Exonic
982088080 4:151856367-151856389 ATTGTAAATAGGTTGAAAAAGGG + Intergenic
982284211 4:153717769-153717791 ATTGAAAGGGGTGGGAAAAAAGG - Intronic
985226300 4:187765119-187765141 AATGTAAGTGAGGGGAAAATAGG + Intergenic
986620346 5:9666449-9666471 ATTATATCTGGGAGGAACAAGGG + Intronic
988181389 5:27798722-27798744 ATTTTAAATGTGGGGAAAGAAGG + Intergenic
988890121 5:35607511-35607533 ATCATAACCAGGGGGAAAAATGG - Intergenic
989837220 5:46008017-46008039 ATTCTAACTGGTGTGAAAGAGGG - Intergenic
992029860 5:72710310-72710332 ATTGTAACAGTGGGGATAATGGG + Intergenic
993339740 5:86708698-86708720 CTTATAATTGGGGGAAAAAAGGG + Intergenic
993922119 5:93818246-93818268 ATTGTAAGTATGGGGAGAAATGG + Intronic
994106142 5:95951436-95951458 ATTAAATCTGGGGGAAAAAATGG - Intronic
994239257 5:97401285-97401307 AGAGTAACTTGGGGGAAAAAAGG - Intergenic
994834836 5:104836128-104836150 ATTGTAAAAAGGGGGTAAAATGG - Intergenic
995134082 5:108661410-108661432 CTTGCTACTTGGGGGAAAAAAGG + Intergenic
996206533 5:120744837-120744859 ATTGTCAATGGGGGGTAAAGTGG + Intergenic
996209166 5:120783852-120783874 AGTGGGAATGGGGGGAAAAAGGG - Intergenic
997336292 5:133111092-133111114 ATTTTCAATGAGGGGAAAAACGG + Intergenic
998095968 5:139395629-139395651 AGTGTAACTGGGGTCAAGAAAGG - Exonic
999023593 5:148199251-148199273 GTTATATTTGGGGGGAAAAAAGG - Intergenic
999364248 5:151011442-151011464 ATTCTAATTGGGAGGAAAATGGG + Intergenic
1001363275 5:171109741-171109763 ATTGAAAATATGGGGAAAAATGG - Intronic
1001942561 5:175750986-175751008 ATTGTAAATGATGGTAAAAATGG - Intergenic
1003411436 6:5866426-5866448 AGTGTAACTGAGGGGAGAATAGG - Intergenic
1003684695 6:8290378-8290400 ACTGTATCTTGGGGGAAAAGGGG - Intergenic
1004018394 6:11753498-11753520 ATTGTAAGTGTGGCAAAAAAAGG - Intronic
1004259062 6:14091794-14091816 ATATTGACTGGGGAGAAAAAGGG + Intergenic
1005013179 6:21355351-21355373 ATGGAAACTGGGGGGATAATGGG + Intergenic
1005020589 6:21414566-21414588 ATTGTATGTTGGGGGAAAAAAGG - Intergenic
1005990703 6:30899943-30899965 ATTGGGATTGGGGGGAAAGAGGG + Intronic
1006656818 6:35602147-35602169 ATTAAAATAGGGGGGAAAAAAGG + Intronic
1008711955 6:54238021-54238043 ATTGTAAAATGGGGGAAAAATGG - Intronic
1008738317 6:54574189-54574211 CTTGTGACTGGGGGAAAGAAAGG + Intergenic
1010512530 6:76738146-76738168 ATATCAACTGGGGGAAAAAATGG - Intergenic
1010732576 6:79406297-79406319 ATTGCAGCTGGGGGAGAAAATGG - Intergenic
1010845755 6:80704800-80704822 ATTGTTGCTAGGGGGAAAAAGGG - Intergenic
1011301855 6:85883724-85883746 ATTGAAAGTGGGGGAAAAGAGGG - Intergenic
1011351097 6:86424895-86424917 AATGTAAAAGGGGGGAAAAGAGG - Intergenic
1011389742 6:86838643-86838665 CTTGAAACTGGGGGGAAAGGAGG + Intergenic
1011709362 6:90036383-90036405 CTTGTAACAGGGGATAAAAATGG + Intronic
1011918532 6:92541494-92541516 AGAGTTCCTGGGGGGAAAAATGG - Intergenic
1012218370 6:96616950-96616972 ATTGAAACTGGGGGCACAACTGG - Intergenic
1013719705 6:113009704-113009726 ATGGTAATTTGGGGAAAAAAAGG - Intergenic
1017067783 6:150546003-150546025 ATTTAAAATAGGGGGAAAAAAGG + Intergenic
1017139641 6:151178964-151178986 AGTGTGACTGGGGGAAACAAAGG + Intergenic
1017738567 6:157384141-157384163 ATTTTAACTGTGGAGAAAATGGG + Intronic
1018426590 6:163688366-163688388 ATTTTAACTTGGGAGAATAAAGG - Intergenic
1020081004 7:5285521-5285543 ATTTTAACTGGGGCCTAAAAGGG - Intronic
1020379029 7:7521777-7521799 TTTGGAAATGGGAGGAAAAATGG - Intronic
1021235907 7:18142369-18142391 ATTGCCACTGGGGGGACAGAAGG - Intronic
1021781201 7:24108583-24108605 ATTTTAAGTGGGGGCAAGAAGGG + Intergenic
1022970968 7:35517041-35517063 ACTGAATTTGGGGGGAAAAAAGG - Intergenic
1023569530 7:41557643-41557665 TTTGTAAGTGGGAGGGAAAATGG - Intergenic
1023702784 7:42909552-42909574 ATCTAAACTGGTGGGAAAAAAGG - Exonic
1023886286 7:44359696-44359718 ATTGAAACTGTGAGGAAACAGGG - Intergenic
1024590913 7:50882114-50882136 ATTGGCACTGGGTAGAAAAAAGG + Intergenic
1025197906 7:56946645-56946667 ATTTTAACTGGGGCCTAAAAGGG + Intergenic
1025674042 7:63630290-63630312 ATTTTAACTGGGGCCTAAAAGGG - Intergenic
1027358918 7:77388062-77388084 ATTCTACCAGGGGGAAAAAAAGG + Intronic
1027433015 7:78133918-78133940 ATTTGGACTGTGGGGAAAAAAGG - Intronic
1028242308 7:88436516-88436538 ATTGTAGATGAGAGGAAAAAAGG + Intergenic
1028808368 7:95055236-95055258 ATTTTAACTGGGGAGAGGAATGG - Intronic
1030250019 7:107432661-107432683 ATTCTAACTAGGAAGAAAAATGG + Intronic
1030974710 7:116107242-116107264 ATTATAATTGGGAGGCAAAAGGG - Intronic
1031375780 7:121024001-121024023 AATCAAACTGGGGGGAAAAAAGG + Intronic
1031774357 7:125888542-125888564 ATTGTGACTAGGTGCAAAAATGG - Intergenic
1031982559 7:128137024-128137046 AGTGTAACTGGGGAGAAAGGGGG - Intergenic
1032151456 7:129433630-129433652 ATTGTTACTGGGGGCAAAAGAGG - Intergenic
1035008179 7:155685926-155685948 ATTCATACTGGGGGGGAAAAGGG - Intronic
1035487420 7:159236960-159236982 ATTGCAGCTGGGGGAAAAATGGG + Intergenic
1036192213 8:6680683-6680705 CTTCTAACTGGGGGGAAAGAAGG - Intergenic
1036192237 8:6680754-6680776 CTTCTAACTGGGGGGAAAGAAGG - Intergenic
1036192262 8:6680829-6680851 CTTCTAACTGGGGGGAAAGAAGG - Intergenic
1036525002 8:9526826-9526848 AATGTGGCTGGGAGGAAAAATGG + Intergenic
1036668637 8:10765229-10765251 AATGTAACTTGGGGGAAATGTGG + Exonic
1036963718 8:13273442-13273464 GATGTAACTGGGCAGAAAAAGGG + Intronic
1038232114 8:25710981-25711003 AGTGGAACTGGGGGGAAAAGGGG - Intergenic
1038428967 8:27484686-27484708 ATGGTAACTGGAGGGAAATGTGG + Intergenic
1039259856 8:35759658-35759680 ATTCTAACGGGTGGGAAGAAAGG + Intronic
1040988237 8:53319592-53319614 ATTTTAACTTGGGGCAAGAAGGG - Intergenic
1041601782 8:59726536-59726558 ATTGTAACTGGAGGGGGGAAAGG - Intergenic
1042351267 8:67780103-67780125 ATTATGACTGGTGGGAAAAGGGG + Intergenic
1042635932 8:70874884-70874906 ATTGGAACTATTGGGAAAAAAGG - Intergenic
1045324459 8:101107848-101107870 GTTTTATCAGGGGGGAAAAAAGG - Intergenic
1045855693 8:106762957-106762979 CTTGTTACTGGGGAGAAAAAGGG - Intronic
1046693184 8:117308861-117308883 GTTGGAATTGGGGGGAAGAAAGG + Intergenic
1046989785 8:120439514-120439536 ATTGCTTCTGGGGGGAAATACGG - Intronic
1047024574 8:120811872-120811894 ATTGGAAAAGGGGGGAAAAGTGG + Exonic
1047555342 8:125923316-125923338 ATGGAGACTGGGGGGAAGAAGGG + Intergenic
1047952492 8:129946692-129946714 CTTATAACTCGGGGGAAATATGG - Intronic
1048980662 8:139702128-139702150 ACTGGAACTCAGGGGAAAAAAGG + Intronic
1049834367 8:144724644-144724666 TTTGTAATTGGGGGGAAACAAGG + Intronic
1050347543 9:4707169-4707191 ATGGTAACTGAGCTGAAAAAGGG - Exonic
1050574041 9:6974071-6974093 ATAGTAACTGGGGGAAAAGGGGG - Intronic
1050723909 9:8624205-8624227 AATGTAACAGGGGGAAAAAAAGG + Intronic
1052441483 9:28501797-28501819 ATTGTAAATCGATGGAAAAATGG - Intronic
1055305767 9:74927679-74927701 CTTGTAACTGGAGGGAAGGAGGG - Intergenic
1055371972 9:75609896-75609918 ATTGTAAATAGGGGCAAAGAGGG + Intergenic
1055798666 9:80005780-80005802 GTTTTCACTGTGGGGAAAAAAGG + Intergenic
1056125827 9:83536093-83536115 ATTGTAATTTGGGGGCAGAAAGG + Intronic
1057923286 9:99117607-99117629 ATTGTACACTGGGGGAAAAAAGG - Intronic
1058284668 9:103162137-103162159 ATTCTAACTGGTGTGACAAATGG - Intergenic
1058875352 9:109239279-109239301 ATTCTTACTGTGGGTAAAAAAGG + Intronic
1060254677 9:122016674-122016696 ATGGTAACTGGAGAGGAAAATGG + Intronic
1060436708 9:123599362-123599384 AGTTTAGCAGGGGGGAAAAAAGG + Intronic
1061818835 9:133211577-133211599 ATAGTAACTGATGGGATAAATGG + Intergenic
1186929132 X:14369415-14369437 ATTAACACTGGAGGGAAAAAAGG + Intergenic
1187096937 X:16158518-16158540 ATTTTAAATTGGGGGAAAAAAGG - Intergenic
1187468183 X:19544175-19544197 ATGGTAACTTGGCAGAAAAAAGG - Intronic
1188611452 X:32103849-32103871 ATAGCCACTGGGGGGAAAAAAGG - Intronic
1188812560 X:34669370-34669392 ATTGTAACTGGGTGTCATAATGG - Intergenic
1189701576 X:43719167-43719189 ATAGTCACTGTGGGGAAACAGGG + Intronic
1190755646 X:53399538-53399560 CTAATAACTGGGAGGAAAAATGG - Intronic
1191858800 X:65649078-65649100 CTTTTTACTGGGAGGAAAAATGG + Intronic
1195716597 X:107825035-107825057 TTTCTAACTTGGGGCAAAAAGGG - Intergenic
1196895568 X:120332450-120332472 ATTTTAACTGGGGGGATCCATGG - Intergenic
1198144312 X:133839596-133839618 TTTATAACTGGGGAGAACAAAGG - Intronic
1198387732 X:136145435-136145457 AATGTAAATGGGAAGAAAAATGG - Intergenic