ID: 930793558

View in Genome Browser
Species Human (GRCh38)
Location 2:55361072-55361094
Sequence AAGTTTTTTGAGATGGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4728
Summary {0: 1, 1: 7, 2: 125, 3: 1431, 4: 3164}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930793558_930793560 29 Left 930793558 2:55361072-55361094 CCAGACTCCATCTCAAAAAACTT 0: 1
1: 7
2: 125
3: 1431
4: 3164
Right 930793560 2:55361124-55361146 AAACCAAAGTATAGATTTTTAGG 0: 1
1: 0
2: 2
3: 41
4: 418

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930793558 Original CRISPR AAGTTTTTTGAGATGGAGTC TGG (reversed) Intronic
Too many off-targets to display for this crispr