ID: 930800977

View in Genome Browser
Species Human (GRCh38)
Location 2:55442407-55442429
Sequence GCGCCGTTTTTTAAGCTGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930800977_930800982 11 Left 930800977 2:55442407-55442429 CCGACCAGCTTAAAAAACGGCGC No data
Right 930800982 2:55442441-55442463 ATATCCCGCACATGGCTCAGAGG 0: 109
1: 508
2: 1576
3: 1811
4: 1204
930800977_930800983 12 Left 930800977 2:55442407-55442429 CCGACCAGCTTAAAAAACGGCGC No data
Right 930800983 2:55442442-55442464 TATCCCGCACATGGCTCAGAGGG 0: 104
1: 505
2: 1571
3: 1806
4: 1228
930800977_930800981 3 Left 930800977 2:55442407-55442429 CCGACCAGCTTAAAAAACGGCGC No data
Right 930800981 2:55442433-55442455 AGGAGATTATATCCCGCACATGG 0: 316
1: 891
2: 1535
3: 1565
4: 1546
930800977_930800986 26 Left 930800977 2:55442407-55442429 CCGACCAGCTTAAAAAACGGCGC No data
Right 930800986 2:55442456-55442478 CTCAGAGGGTCCTACGCCCATGG 0: 539
1: 1463
2: 1379
3: 1045
4: 1011

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930800977 Original CRISPR GCGCCGTTTTTTAAGCTGGT CGG (reversed) Intergenic
No off target data available for this crispr