ID: 930803788

View in Genome Browser
Species Human (GRCh38)
Location 2:55469875-55469897
Sequence CTGTATTAGTAGAATGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930803785_930803788 28 Left 930803785 2:55469824-55469846 CCCAGGAAAGCAAGGGTTGTTCA No data
Right 930803788 2:55469875-55469897 CTGTATTAGTAGAATGAAATGGG No data
930803786_930803788 27 Left 930803786 2:55469825-55469847 CCAGGAAAGCAAGGGTTGTTCAG No data
Right 930803788 2:55469875-55469897 CTGTATTAGTAGAATGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930803788 Original CRISPR CTGTATTAGTAGAATGAAAT GGG Intergenic
No off target data available for this crispr