ID: 930806407

View in Genome Browser
Species Human (GRCh38)
Location 2:55494986-55495008
Sequence CAGCTACTCACTTGGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930806401_930806407 6 Left 930806401 2:55494957-55494979 CCGGGCATGGTGGCACACGCCTG 0: 1239
1: 18444
2: 73906
3: 170024
4: 230072
Right 930806407 2:55494986-55495008 CAGCTACTCACTTGGGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930806407 Original CRISPR CAGCTACTCACTTGGGAAGC TGG Intergenic
No off target data available for this crispr