ID: 930807185

View in Genome Browser
Species Human (GRCh38)
Location 2:55502851-55502873
Sequence AAATTTGACTAGAAGCCAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930807185_930807187 -4 Left 930807185 2:55502851-55502873 CCGACTGGCTTCTAGTCAAATTT No data
Right 930807187 2:55502870-55502892 ATTTGGCCAATGAGAGTTACTGG No data
930807185_930807189 3 Left 930807185 2:55502851-55502873 CCGACTGGCTTCTAGTCAAATTT No data
Right 930807189 2:55502877-55502899 CAATGAGAGTTACTGGTGAGAGG No data
930807185_930807190 24 Left 930807185 2:55502851-55502873 CCGACTGGCTTCTAGTCAAATTT No data
Right 930807190 2:55502898-55502920 GGAAAGACGCCATTCTGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930807185 Original CRISPR AAATTTGACTAGAAGCCAGT CGG (reversed) Intergenic
No off target data available for this crispr