ID: 930817673

View in Genome Browser
Species Human (GRCh38)
Location 2:55616271-55616293
Sequence CTTTTGTTCTTAATGAGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 437
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 396}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930817673_930817676 17 Left 930817673 2:55616271-55616293 CCTTTCCTCATTAAGAACAAAAG 0: 1
1: 0
2: 1
3: 39
4: 396
Right 930817676 2:55616311-55616333 TGATGACTATTTAAAATAAAAGG 0: 1
1: 0
2: 3
3: 63
4: 657
930817673_930817677 18 Left 930817673 2:55616271-55616293 CCTTTCCTCATTAAGAACAAAAG 0: 1
1: 0
2: 1
3: 39
4: 396
Right 930817677 2:55616312-55616334 GATGACTATTTAAAATAAAAGGG 0: 1
1: 1
2: 3
3: 67
4: 670

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930817673 Original CRISPR CTTTTGTTCTTAATGAGGAA AGG (reversed) Intronic
906957110 1:50383576-50383598 CTTTTGTTGTTATTGAGTATGGG + Intergenic
907487277 1:54786786-54786808 CTTTTGTTTTGAATGAAGAGAGG + Intronic
907567250 1:55446923-55446945 CTTTTATTTTTAATGAAGACAGG - Intergenic
908697064 1:66855426-66855448 GTTTTGTTCTTATTGAGGTATGG - Intronic
908728971 1:67206681-67206703 TTTTTTTTTTTAATGGGGAATGG + Intronic
908936346 1:69381853-69381875 CTTTTTTTTTTAACTAGGAAAGG - Intergenic
909121963 1:71614706-71614728 CTTTTGTTTATAATGAGTCATGG - Intronic
909954756 1:81765787-81765809 CTTTTGTCCTTAATGAAATAAGG - Intronic
910175907 1:84429981-84430003 CTCTTGTCCTTATTGAGGGAGGG - Intergenic
910368447 1:86490515-86490537 GTTTTCTTCTAAATGAGGAAAGG - Intronic
910672746 1:89789447-89789469 ATTTTGTTCTTTATGAGACAGGG - Intronic
911710755 1:101069455-101069477 ATTTAGTTGTTAATGAGAAATGG + Intergenic
912048751 1:105495333-105495355 CTTTTGTTTTTTTTGAGGCAGGG - Intergenic
915277804 1:154801572-154801594 ATTTTGTTCTTACTGAATAAAGG - Intronic
916282172 1:163063806-163063828 CTTTTGTTCTCCCTGAGCAAAGG + Intergenic
916787841 1:168099095-168099117 CTTTCGTCCTCAAGGAGGAAGGG - Intronic
916966996 1:169957929-169957951 CTTTTTTTCTTAAAGAGACAGGG + Intronic
918256913 1:182757009-182757031 TTTTTTTTTTTAATGAGGCAGGG - Intergenic
918298473 1:183180556-183180578 CCTTTGTTCTTAATTGGTAAAGG - Intergenic
918481900 1:184987241-184987263 CTTTTGTACAAAATTAGGAATGG - Intergenic
919064618 1:192677966-192677988 CTTTCATTCTTAATAAGGAAAGG + Intergenic
919533615 1:198757773-198757795 CTTTACTTATTAATGAGAAAAGG + Intergenic
920919211 1:210284412-210284434 CTTTTGTTGTTTCTGAGGCAGGG - Intergenic
921332837 1:214057234-214057256 CTTTTGTGTCTAAAGAGGAAGGG + Intergenic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
921779564 1:219146432-219146454 CTTTGGTTCTTAATGGGGATAGG - Intergenic
922225019 1:223638596-223638618 CTTTTGTCCTGAATATGGAAAGG - Intronic
922848753 1:228713002-228713024 CTTTTTTTTTTAACCAGGAATGG + Intergenic
923508415 1:234627038-234627060 ATTTTATTTTTAATGAAGAAAGG + Intergenic
923797533 1:237172500-237172522 TTTTTTTTTTTAATGAGGAAAGG + Intronic
923858299 1:237867936-237867958 CTTTTGTCCTCAAGGAGGAGTGG - Intergenic
924264173 1:242264431-242264453 TTTTTCTTCTTCAGGAGGAAGGG + Intronic
1062905866 10:1179427-1179449 GTTTTGTTTTTGCTGAGGAAAGG - Exonic
1063633536 10:7758016-7758038 TTTTTTTTTTTAATGAGGACAGG + Intronic
1063891272 10:10631209-10631231 GCTTTGTTTCTAATGAGGAAAGG - Intergenic
1064294193 10:14063550-14063572 TTTTTTTTTTTAATGAGAAAAGG - Intronic
1064534947 10:16349184-16349206 CTTTTGCTCTGAATGAAGAAGGG + Intergenic
1066204412 10:33173463-33173485 CTTTTTTTTTTAATGAGACAGGG - Intergenic
1066720624 10:38334034-38334056 TTTTTCTTCTTCAGGAGGAAGGG - Intergenic
1067791418 10:49290917-49290939 CTGTTCTTTTTAATGAGAAATGG + Intergenic
1068691885 10:59924965-59924987 CCTGTGTTTTTAATCAGGAAAGG - Intergenic
1070122019 10:73587092-73587114 CTTTAGATCTTTATAAGGAAGGG - Intronic
1070198149 10:74177536-74177558 CTTTTTTTGTTAATGAGGACAGG + Intronic
1070962328 10:80507697-80507719 CTTTTGATCTTAGCCAGGAAGGG - Intronic
1071217072 10:83418525-83418547 GTTTTGTTATTAATAAGTAAGGG + Intergenic
1071440200 10:85683554-85683576 CTGCTGCTTTTAATGAGGAAAGG - Intronic
1071537364 10:86445529-86445551 TTTTTTTTTTTAATGAGAAAGGG + Intronic
1072499341 10:95997394-95997416 CTTTTTTTTTTAATTAGGACAGG + Intronic
1072500545 10:96012617-96012639 CTACTGTTTTTAATGATGAAGGG + Exonic
1072718414 10:97766506-97766528 CTTTTGTCCCTGAGGAGGAATGG - Intergenic
1073193705 10:101670746-101670768 CTTATGTTCTTAATGAGCCTGGG - Intronic
1074596899 10:114876218-114876240 CTTCTGTTCTCCCTGAGGAAAGG - Intronic
1075148554 10:119905126-119905148 CTTTTTTTTTTTCTGAGGAAGGG - Intronic
1075487568 10:122838084-122838106 CTTATGTACTTACTGGGGAAAGG - Intronic
1077680312 11:4233893-4233915 CCTAAGTTCTTACTGAGGAAGGG - Intergenic
1077684590 11:4279313-4279335 CCTAAGTTCTTACTGAGGAAGGG - Intergenic
1077685452 11:4287456-4287478 CCTAAGTTCTTACTGAGGAAGGG + Intergenic
1077689722 11:4330470-4330492 CCTAAGTTCTTACTGAGGAAGGG - Intergenic
1077690603 11:4338617-4338639 CCTAAGTTCTTACTGAGGAAGGG + Intergenic
1078940075 11:15993289-15993311 TTTTTGCACTTAATGATGAATGG - Intronic
1079730276 11:23932101-23932123 TTTTTGTTTTTCATTAGGAATGG + Intergenic
1080688851 11:34538574-34538596 CTTTGGTTCTTAATGAGTTTTGG + Intergenic
1080752591 11:35164751-35164773 TTTGTGTTCTTAATAATGAAGGG + Intronic
1081089250 11:38842191-38842213 CTTTTCTTTTTACTGAGAAAAGG - Intergenic
1081206430 11:40280952-40280974 TTTTTGTTGTTAATAGGGAATGG + Intronic
1081261133 11:40962293-40962315 CTTTCCTTCTAAATGATGAAGGG - Intronic
1081848306 11:46257219-46257241 CTTTTGTTTTTAATGAGACAGGG + Intergenic
1081865877 11:46360477-46360499 TTTTTTTTTTTGATGAGGAAAGG - Intronic
1082279693 11:50258439-50258461 CATCTGTTCTTAAGGAGGATGGG - Intergenic
1082931173 11:58607098-58607120 CCTTTCTTCTTCATGATGAAAGG - Intronic
1083977106 11:66131946-66131968 TTTTTTTTTTTAATGAGGAAGGG - Intronic
1085760804 11:79239633-79239655 CTTTTGTTCTTCTTGAGCACAGG - Intronic
1086302750 11:85446051-85446073 CTCTTTTACTTAAAGAGGAAGGG - Intronic
1087193014 11:95275674-95275696 CTTTCTTTTTGAATGAGGAATGG + Intergenic
1087556543 11:99728945-99728967 CTTTTCATCTTAATGAGCATAGG + Intronic
1087912311 11:103768166-103768188 ACTATGTGCTTAATGAGGAAGGG - Intergenic
1088535820 11:110859791-110859813 GTTTTGTCTTTAATGAGGGAGGG - Intergenic
1089107100 11:116020772-116020794 CTTTTGTTCTTGATCAGGTTTGG + Intergenic
1091246504 11:134100157-134100179 ATTTTTTTTTTAAGGAGGAAAGG - Intronic
1091635873 12:2196145-2196167 CTTTTGTACTTAAAGTGGATGGG + Intronic
1092328505 12:7560403-7560425 CTTTTATTCTGAATGAGATAGGG - Intergenic
1092862731 12:12733360-12733382 CTTTTGGTCTTAATGTGCTATGG - Intronic
1092957825 12:13565886-13565908 CTCTTGAGCTTAATCAGGAAGGG - Intronic
1093547585 12:20367519-20367541 CCTTAGTTATTAATGAGTAAAGG - Intergenic
1093795599 12:23306819-23306841 CTGTTGGTCTTAATGAGTTAAGG - Intergenic
1094092188 12:26662677-26662699 GTTTTGTTTTTTATGAGGCAGGG + Intronic
1095258308 12:40067907-40067929 CTTTTTTTCTTGTTGAAGAAAGG + Intronic
1095473414 12:42560907-42560929 TTTTTGTTCTTTTTGAGGATAGG - Intronic
1096860862 12:54527170-54527192 CTATTGTTCTTAATAGAGAAGGG + Intronic
1097844284 12:64351047-64351069 CTTTTGTTCCTTATGAGCTATGG - Intronic
1098106180 12:67070088-67070110 CTTTTGTTTTAAATGATGCAGGG + Intergenic
1100063066 12:90605257-90605279 CTAATGTTTTTAATGAGGAGTGG - Intergenic
1100318606 12:93468097-93468119 CCTTTGTTCTTAATCTGAAATGG + Intronic
1100446790 12:94668456-94668478 TTTTTTTTTTTAATGAGGCAGGG - Intergenic
1101216316 12:102587911-102587933 TTTTTTTTCTTAATGATGCAAGG + Intergenic
1102277525 12:111594662-111594684 TTTTTATTTTTAATGGGGAAGGG + Intronic
1103398192 12:120624108-120624130 CATCTGTTCTTAATGAGAAATGG + Intergenic
1104346461 12:128004098-128004120 CTTTTAATATTCATGAGGAAAGG + Intergenic
1106052749 13:26206905-26206927 TTTTTTTTTTTAAGGAGGAAGGG - Intronic
1106836463 13:33640517-33640539 CTCTTGTGCTTAGTGAGGGAAGG - Intergenic
1107118505 13:36773187-36773209 CATTAGATCTTACTGAGGAAAGG - Intergenic
1107442238 13:40438388-40438410 CCTCTGTTCTTTATGAGGCAGGG - Intergenic
1108682134 13:52789658-52789680 ATTTTTTTCTTCAGGAGGAATGG - Intergenic
1109101549 13:58190681-58190703 CTTTAGTTCTAAAAGAGGACTGG - Intergenic
1109613849 13:64804394-64804416 CTTTTGTAATTAATGAAGAAAGG + Intergenic
1111340843 13:86883270-86883292 CTCTTCTTGTTCATGAGGAAGGG - Intergenic
1112132785 13:96542158-96542180 GTGTTGTTCTTAATGAGCCAGGG - Intronic
1112720600 13:102239978-102240000 ATTTTGTTCTGATTGGGGAAAGG + Intronic
1112896907 13:104310623-104310645 TTTTTTTTTTTAATCAGGAATGG + Intergenic
1114779613 14:25523425-25523447 CTTTTGTTATTAATCAAGAAAGG + Intergenic
1115751673 14:36499702-36499724 CTTGTGTTCCTAATAAGAAATGG - Intronic
1116089699 14:40289589-40289611 TTTTTTTTCTAAATGAGAAAAGG + Intergenic
1116114929 14:40635792-40635814 CTTTTCTTCTTCTTGAGGAGAGG + Intergenic
1116405642 14:44562591-44562613 CATTTGCTCTTAATGAAGCATGG - Intergenic
1117709857 14:58516303-58516325 CTTTTGTTCTTAAAGGAGAAGGG - Intronic
1117942058 14:60978753-60978775 CTTTTGTTTTTATTGATGAAGGG - Intronic
1118248801 14:64138227-64138249 TTTTTGTTTTTAAGGAGGCAAGG + Intronic
1119823884 14:77641450-77641472 CTTTTTTTTATAATGAGGTAGGG - Intergenic
1119944433 14:78677248-78677270 CATTTGTGATTAATGAGGAAAGG + Intronic
1120855033 14:89204854-89204876 CTTTTGTTCTCAATGATGGATGG - Intronic
1121386720 14:93534083-93534105 CTTCTGTTCAAAAAGAGGAAGGG + Intronic
1121402565 14:93693061-93693083 TTTTGGTTCTTAATTAGAAAGGG + Intronic
1121833978 14:97075854-97075876 TTTTTTTTTTTAATGAGGAAAGG + Intergenic
1124446793 15:29741750-29741772 CATTTTATCATAATGAGGAAAGG - Intronic
1124818144 15:33017633-33017655 CTTATGTGTTGAATGAGGAAAGG - Intronic
1124825337 15:33088838-33088860 CATTTTTGCTTCATGAGGAAAGG - Exonic
1125024635 15:35018483-35018505 GTTTTTTTCTTAGTAAGGAATGG + Intergenic
1125041623 15:35194419-35194441 CTTTTACTTCTAATGAGGAAGGG - Intergenic
1126311964 15:47327679-47327701 ATGTTTTCCTTAATGAGGAAAGG - Intronic
1126378803 15:48024642-48024664 CTTTTCTTCTAAATGGGAAAGGG + Intergenic
1126437963 15:48655246-48655268 CTTATTTTCCTAAAGAGGAAAGG - Intergenic
1126976461 15:54187398-54187420 GTTTTGATCTTTATGAGCAATGG - Intronic
1127168666 15:56275292-56275314 CTTTTGTTCTTAGTGGACAAAGG + Intronic
1127752742 15:62061787-62061809 TTTATCTTCTTAAAGAGGAATGG - Intergenic
1129120873 15:73395772-73395794 CTTCAGTTCCTAATGAGAAATGG + Intergenic
1131672767 15:94637728-94637750 TTTTTTTTTTTAATGAGGGATGG - Intergenic
1132253673 15:100354819-100354841 TTTTTTTTTTTAATCAGGAACGG - Intergenic
1133847625 16:9470179-9470201 CTTTTGTTCTTGACAATGAATGG - Intergenic
1134745417 16:16584400-16584422 CTGTTCTTCTTAGTGAAGAAAGG - Intergenic
1135064728 16:19299918-19299940 CTTTTGTTAAGAATAAGGAAAGG + Intronic
1135731699 16:24900062-24900084 GTTTTTTTCTTAATGTGGTAAGG + Intronic
1137878028 16:52016102-52016124 CTTTTCTTCTTTAAGAGCAAAGG - Intronic
1138824437 16:60302067-60302089 CCTTTGTTCTTAATGAATATAGG + Intergenic
1140854883 16:78969275-78969297 TTTTTTTTCTTTTTGAGGAAGGG + Intronic
1141398227 16:83723710-83723732 CTTCTGTTCTACAAGAGGAAGGG - Intronic
1142632845 17:1236691-1236713 TTTTTGTTTTTAGTGAGGATGGG - Intergenic
1142682761 17:1560218-1560240 GTTTTGTTCCTAAGGAGCAAGGG - Intronic
1143394024 17:6577589-6577611 TTTTTGTTCTTCATGAACAAGGG - Intergenic
1145755206 17:27385246-27385268 GTTCTGTTGTTAAGGAGGAAGGG - Intergenic
1145839966 17:27986111-27986133 CTTTGGTTATCAATGAGGAAGGG - Intergenic
1145871671 17:28278661-28278683 GTTTTGTTTTTAATGGAGAAAGG + Intergenic
1146826860 17:36030619-36030641 TTTTTTTTTTTAATAAGGAAAGG - Intergenic
1147171382 17:38621185-38621207 TTTTTCTTTTTAATGAGGCAGGG + Intergenic
1147477902 17:40730976-40730998 CTTTTGTTTTTAATGACAAATGG + Intergenic
1148081861 17:44971212-44971234 TTTTTGTTCTTAATGAGACAGGG - Intergenic
1149102743 17:52925822-52925844 CTTTTTTTCATAGTGAGAAAAGG - Intergenic
1149118900 17:53137015-53137037 CTTTTCTACTTAAGCAGGAAGGG - Intergenic
1149797732 17:59536218-59536240 CTATTTTTTTTAATGAAGAAAGG - Intergenic
1150254302 17:63731869-63731891 CTTTTGTTTTTTATGAGACAGGG + Intronic
1150678259 17:67263451-67263473 TTTTTGTTTTTAATGAGACAGGG + Intergenic
1150929752 17:69571988-69572010 CGTTTGTTCTTATTGAGGGTGGG + Intergenic
1151078725 17:71304142-71304164 CTTTTATTATTATTGAGTAATGG + Intergenic
1151121908 17:71802008-71802030 CTTTTGTTATTAACTAGTAATGG + Intergenic
1152891841 17:82886449-82886471 TTCTTGTTCATCATGAGGAAGGG + Intronic
1153786392 18:8538813-8538835 GTTTTGTTATTAAGGAGAAAGGG - Intergenic
1153861294 18:9210761-9210783 TTTTTTTTTTTATTGAGGAAAGG + Intronic
1154141302 18:11826652-11826674 CTGGTGGACTTAATGAGGAAAGG + Intronic
1154435280 18:14337477-14337499 CTTTTGTTCTTTCTGAGGTTGGG + Intergenic
1155290848 18:24340091-24340113 ATTTTCTACTTAATGAGTAAAGG - Intronic
1155327880 18:24683887-24683909 CTTTTGTTCTTGTTTATGAAGGG + Intergenic
1155869936 18:31014771-31014793 CTTGTGGGCTTAATGAGGTATGG + Intronic
1156097799 18:33556873-33556895 ATTGTGTACTTAATGAAGAAAGG + Intergenic
1157239316 18:45995064-45995086 GTTTTGTTTTTTATGGGGAAGGG + Intronic
1157509272 18:48257849-48257871 GTTTTTTTCTTAATCAGAAATGG - Intronic
1158653903 18:59311336-59311358 GTTCTGTTCTTAATAAGGGAAGG - Intronic
1159440196 18:68468856-68468878 TTTTTGTTCTTAATACTGAAAGG - Intergenic
1159897049 18:74007382-74007404 CTTTTCTTCTTAATGACAATGGG - Intergenic
1160976264 19:1794196-1794218 CTTTTGTTGTTGATGGGGCACGG + Intronic
1161148309 19:2692977-2692999 CTTTTCTTTTTAATGAGATAGGG - Intronic
1163240523 19:16060196-16060218 CTTTTTTTCTTAAAGAGACAGGG - Intergenic
1164588430 19:29492260-29492282 CTTTTCTTTTTAATCATGAATGG + Intergenic
1166336253 19:42109477-42109499 ATTGTGTTCAAAATGAGGAAGGG + Intronic
1167661705 19:50799319-50799341 CCTCTGTTCTTAATGAGTGATGG + Exonic
1168556629 19:57348166-57348188 TTTTTGTTCTTTATGAGAGACGG + Intergenic
1168598216 19:57696099-57696121 CATTTGTTCTTAAATTGGAAAGG + Intronic
925506389 2:4569497-4569519 CCTTTCTTCTTCTTGAGGAAAGG - Intergenic
925522534 2:4763037-4763059 CTTTTTTTCTCAAGGAGAAAAGG + Intergenic
925661360 2:6206484-6206506 CTTATGTTCTTATTTACGAATGG - Intergenic
926510449 2:13770710-13770732 CTTCTGTTCTGGAAGAGGAAAGG - Intergenic
927279279 2:21289656-21289678 CTTTTGTTCTCCCTGGGGAAAGG - Intergenic
927370605 2:22350831-22350853 CTTTCGAGCTTAATGAGGAGAGG - Intergenic
927729487 2:25458368-25458390 CTTTTTTTCTAAATGGGAAAAGG + Intronic
928128308 2:28630979-28631001 CTTTTGTTTTTAATGAAGGGAGG - Intronic
928484055 2:31711678-31711700 CTTTTCTTCTGTTTGAGGAAAGG + Intergenic
928922554 2:36540639-36540661 ATTTTGTTCTTTATAGGGAATGG + Intronic
929178899 2:39011432-39011454 CTTTTGGTCTAAAGGAGGAGAGG + Intronic
929262476 2:39881254-39881276 CTATTGCTTTTAATGAAGAAAGG + Intergenic
929936020 2:46295324-46295346 ATCTTGTTTTTAAAGAGGAAAGG - Intronic
930511511 2:52350970-52350992 TTTTTGTTCTAAACGAGGACTGG + Intergenic
930817673 2:55616271-55616293 CTTTTGTTCTTAATGAGGAAAGG - Intronic
931209733 2:60181067-60181089 CTTTTGTTCTTTTTGAAGGAAGG - Intergenic
932724115 2:74162967-74162989 AAATTGTTCTTAACGAGGAATGG - Intronic
932916626 2:75866040-75866062 CTATTGTTCAGAATTAGGAAAGG - Intergenic
933109033 2:78373861-78373883 CTTTGGCTCTTCATGAGGAAAGG - Intergenic
933630277 2:84648145-84648167 TTTTTGTTCTAAATGAGAAAAGG + Intronic
935426270 2:102921307-102921329 TTCTTCTTCTTAATGAAGAAAGG + Intergenic
937020841 2:118653074-118653096 CTTTTTTTTTTAATTAGGTATGG + Intergenic
939733729 2:145817645-145817667 TTTTTTTTCTAAATGAGAAAAGG - Intergenic
939867263 2:147486769-147486791 CTTTTGTTCTTTTTGAGGCAAGG + Intergenic
942001530 2:171652865-171652887 CTTTTGTTCTTCTTGAGGGGAGG - Intergenic
943371187 2:187018083-187018105 ATTTTATTCTTAATGATGTAGGG - Intergenic
944177231 2:196845660-196845682 TTTTTGTTGTTAAAAAGGAAAGG - Intronic
945187918 2:207158274-207158296 CCATTGTCCCTAATGAGGAAAGG - Intronic
945958174 2:216105620-216105642 CTTTTGTTGTGGAGGAGGAAGGG + Intergenic
947024932 2:225726825-225726847 CTGTTCTGCTTCATGAGGAAGGG + Intergenic
947209492 2:227695043-227695065 CTTTTGTTCTTTTTGAGACAGGG - Intronic
948110755 2:235453766-235453788 GTTTTGTTGTTAAACAGGAAGGG + Intergenic
1169025426 20:2366778-2366800 GTTTTGTTTTTAAAGAAGAACGG + Intergenic
1169558527 20:6773963-6773985 CTTTTGTTCTAAATAAAGTATGG - Intronic
1172826343 20:37790267-37790289 CTTTTGTTCCTAATGAACATCGG + Intronic
1173722720 20:45273569-45273591 TCTTTGTTCTTAATTAGAAAAGG + Intergenic
1173748379 20:45455916-45455938 CTTTGGTTGTTACTGAGGGAGGG + Intergenic
1177807440 21:25888149-25888171 TTTTTGTTCTTACTGAAGTAGGG + Intronic
1178616436 21:34137785-34137807 TTTTTTTTTTTAATCAGGAATGG + Intronic
1180898610 22:19355163-19355185 CTTTGGTTCTTAAGGACCAAAGG + Intronic
1181962300 22:26631220-26631242 GTTTTGTTTTTAATGAGTCAAGG + Intergenic
1182937938 22:34243863-34243885 CTTTTATTTTTATGGAGGAAAGG - Intergenic
1183320114 22:37160146-37160168 GTTGTGTTCTTAATCAGTAAGGG - Intronic
1184143797 22:42596254-42596276 CTTTTGTTCGAATAGAGGAAGGG + Exonic
1184237390 22:43190556-43190578 TTTTTTTTCTTTTTGAGGAAGGG + Intergenic
949154017 3:807640-807662 TTTTTTTTCTAAATGAGAAATGG + Intergenic
949705285 3:6809413-6809435 CTTTTGTTCTTCGAGATGAATGG - Intronic
949744637 3:7275532-7275554 ATCTTCTACTTAATGAGGAAGGG - Intronic
950396456 3:12737746-12737768 CTCTTGTTCTTAAGGAGAAGTGG - Exonic
951188059 3:19736822-19736844 CTTTTGTTGTAATTTAGGAATGG - Intergenic
951423065 3:22510499-22510521 CTTTTCCTCTGATTGAGGAAAGG + Intergenic
952200953 3:31126788-31126810 CTTATTTTCTTAATGAGTGAAGG - Intergenic
956112295 3:65881619-65881641 CTTTTTTTTTTTTTGAGGAAGGG - Intronic
956482521 3:69687450-69687472 CAGTTCATCTTAATGAGGAAGGG + Intergenic
956604525 3:71059811-71059833 CTTTAGTTCTTAAAGGGAAAAGG + Intronic
957516176 3:81254572-81254594 CCTATGCTCTTAATGTGGAAAGG + Intergenic
959728599 3:109574246-109574268 CTTTTTTTTTTAATGAGACAGGG + Intergenic
960101066 3:113744455-113744477 TTTTTTTTTTTAATGAGGCAGGG - Intronic
960632833 3:119750475-119750497 CCTTAGTTCTTAATGTGGAAGGG - Intronic
961101074 3:124199619-124199641 CCTTTTTTCTTAAAGAGTAAAGG + Intronic
961213084 3:125140724-125140746 TTTTTTTTCTTAAAGAGGCAGGG + Intronic
962788598 3:138790439-138790461 TTTTTTTTTTTAATGAGGACAGG - Intronic
963579860 3:147111777-147111799 GTTTTGGTCTTGATGAGCAATGG - Intergenic
963621875 3:147619926-147619948 CCTTTTTTCTTAATCACGAAAGG + Intergenic
964032022 3:152149126-152149148 CTTCTGTTCATAAGGATGAAAGG - Intergenic
964163348 3:153672002-153672024 CTTTTGGTATTAAGGAGCAATGG - Intergenic
964249620 3:154697573-154697595 TTTTTTTTCTTAGTAAGGAATGG + Intergenic
964410902 3:156396895-156396917 CGTTTCTTCTTAATTAGGACAGG + Intronic
964591997 3:158375372-158375394 TTTTTTTTCTTAATGAGATATGG + Intronic
964744267 3:159997628-159997650 CTTTTTCTATTAAGGAGGAATGG - Intergenic
964939204 3:162134054-162134076 CTTTTTTTCTAAATGGGAAAAGG - Intergenic
965004925 3:163008242-163008264 CTTTTTTTCTTATTGAGACAGGG - Intergenic
966823706 3:183945500-183945522 CAATTGTTCTTAATCAGGGATGG - Intronic
967901566 3:194458703-194458725 CAATAGTTCTTAATCAGGAATGG + Intronic
968946984 4:3670259-3670281 CTTTTATTTTTACTGGGGAAGGG - Intergenic
970103132 4:12548025-12548047 TTCTTGGTCTTGATGAGGAAGGG - Intergenic
970569992 4:17370622-17370644 CTTTTCTTTTTACTAAGGAAGGG - Intergenic
971137730 4:23888265-23888287 ATTTTTTTCTTAAGGAGGAAAGG - Intronic
971514141 4:27465784-27465806 TTTTTGCTTTTAATGATGAAAGG + Intergenic
971719271 4:30224701-30224723 TTTTTCTTCTTAAAAAGGAAAGG + Intergenic
972113878 4:35603137-35603159 ATTTTGTTGTAAATGTGGAAAGG - Intergenic
972695316 4:41439575-41439597 CTTTTTTTTTTAATGAGACAGGG - Intronic
973981738 4:56313762-56313784 CGTTTGTTCATATTAAGGAAAGG + Intronic
974108995 4:57504699-57504721 CTTGTCTTCTTAATGCCGAAAGG - Intergenic
974290577 4:59924650-59924672 TTTTTTTTCTAAATGAGAAAAGG - Intergenic
976243626 4:82985890-82985912 CTTTTTTTCTTCATGGGGATTGG - Intronic
976346172 4:84004155-84004177 CTTTTGTACTTAAAAAGGGAGGG - Intergenic
977455351 4:97252740-97252762 CTTTTGTTGTTGATGACAAAAGG - Intronic
978281548 4:107021955-107021977 CATTTTCTGTTAATGAGGAAAGG + Intronic
978691664 4:111520054-111520076 CTTTTTTTCTTTATTAGGAGAGG + Intergenic
978874103 4:113617668-113617690 TTTTTGTTCTTAATTTGAAATGG + Intronic
979023262 4:115530685-115530707 CTCTACTTCTTAATAAGGAATGG - Intergenic
979087836 4:116436331-116436353 CTTTTGTTCTGAAGGAGAAATGG + Intergenic
979807860 4:124996901-124996923 TTTTTTTTTTTAATGAGGCAGGG - Intergenic
980824323 4:138055193-138055215 CTTTTGTTCTTGATGTTTAAAGG + Intergenic
981108714 4:140911052-140911074 ATTTTTTTCTTTTTGAGGAAAGG + Intronic
981126295 4:141110582-141110604 AATTTTTTTTTAATGAGGAAGGG + Intronic
981481782 4:145245965-145245987 ATTATTTTCTAAATGAGGAAAGG - Intergenic
982259525 4:153482181-153482203 GTTTTTTTCTTAAAGAGGATGGG + Intronic
982634906 4:157882705-157882727 TTTTTCTTCTTAATGAAGATAGG - Intergenic
984133373 4:175905845-175905867 CTTTTTTTCTTAATGACGAAAGG - Intronic
985124374 4:186677492-186677514 TTTTTTTTTTTAATGAAGAACGG + Intronic
985587626 5:749065-749087 CCTCGGTACTTAATGAGGAAGGG - Intronic
987087697 5:14485675-14485697 CTTATTTTTTTAATGGGGAAAGG - Intronic
988194290 5:27981831-27981853 CATTTCTTCTTCATGAGGAAAGG + Intergenic
988328456 5:29802152-29802174 CAGTTGTTCTTAATCATGAATGG - Intergenic
988606792 5:32685473-32685495 CTTTTGTTCTTAATCTGTAATGG - Intergenic
988700427 5:33668508-33668530 TTTTTTTTCTTTATGAGGCAGGG + Intronic
990039751 5:51364546-51364568 CTTTTTTTATTAATTAGCAAAGG + Intergenic
991674863 5:69080651-69080673 CTTTAGAACATAATGAGGAAAGG + Intergenic
992419416 5:76587210-76587232 CATTTATTCTTTATGAGTAAAGG - Intronic
992582941 5:78200641-78200663 TTGTTGTTTTTAATGAGGCAGGG - Intronic
994844560 5:104970595-104970617 ATTTTCTTCTAAATGATGAAAGG + Intergenic
994945460 5:106382610-106382632 CTTTTACTTTTAATGAGGCAGGG + Intergenic
997754720 5:136385578-136385600 CATTTCTTATTAATCAGGAAAGG - Intronic
998221195 5:140281863-140281885 CTTTTTTTTTTAATGAGACAGGG - Intronic
998367873 5:141642764-141642786 TTTATGTTCTTTATGAGGTAAGG - Intronic
999761440 5:154704158-154704180 CTTTTTTTCTAAATGAGAAATGG + Intergenic
1000743520 5:165000543-165000565 GTTTTGTTGTAAATGAAGAAAGG - Intergenic
1001143725 5:169166271-169166293 CACATGTTCTTAATGAGAAAAGG + Intronic
1001774263 5:174316815-174316837 CTTCTGTGCCAAATGAGGAAGGG + Intergenic
1003432712 6:6054797-6054819 CTTTTTTTCTTCACAAGGAAAGG - Intergenic
1004293257 6:14387475-14387497 GTTTTTTTTTTAATAAGGAAAGG + Intergenic
1005302809 6:24487455-24487477 GTTTGGTACTTAATGAAGAAGGG + Intronic
1005417567 6:25617683-25617705 CTTTTGTTCTTAGTAATTAAAGG + Intronic
1005421700 6:25657801-25657823 CTTTGGTCCTTCATGAGTAAAGG + Intronic
1005443024 6:25891849-25891871 ATTTTGATATTAATGAAGAAGGG + Intergenic
1005584725 6:27265372-27265394 CCTATGTACTTTATGAGGAAAGG - Intergenic
1008170495 6:48199636-48199658 CTTTTGTTATTCAGGAGGATAGG + Intergenic
1008430699 6:51413391-51413413 CCTTTGTTCATAATGTTGAAAGG + Intergenic
1008593215 6:53014475-53014497 GTTTTGTTCTTGATAGGGAAGGG - Intronic
1008941426 6:57050000-57050022 CTTTTTTTTTTAATGAGGTAGGG + Intronic
1009824689 6:68852273-68852295 CTTTTATTCTTAATTAGTAAGGG + Intronic
1010425429 6:75723851-75723873 TTTTTTTTCTTTATGAAGAAAGG + Intergenic
1010694206 6:78949694-78949716 TTTTTGTTGTTAATGAGATAGGG + Intronic
1010991258 6:82482766-82482788 ATTTTTTTCTAAATTAGGAATGG + Intergenic
1012516549 6:100068212-100068234 CTTTTTTTCTAAATGGGAAAAGG - Intergenic
1013643680 6:112113677-112113699 CATTTTTTCCTACTGAGGAAGGG + Intronic
1015112136 6:129604773-129604795 CTTTTTTTCTGATTTAGGAAAGG + Intronic
1016169130 6:140987236-140987258 AATCTGTTCTTAATCAGGAAAGG + Intergenic
1017364855 6:153623503-153623525 CTTTTGTTTCTAAACAGGAAAGG - Intergenic
1018630871 6:165821320-165821342 TTTTTGTTCTGAAGGGGGAAAGG - Intronic
1018753659 6:166829799-166829821 CTTTTCTTCTTAAGGCTGAACGG - Intronic
1021283309 7:18747090-18747112 ATTTTGATCTTTTTGAGGAAAGG + Intronic
1022250699 7:28605033-28605055 CTCTTTTTTTTAATGAGAAAGGG - Intronic
1022348601 7:29543758-29543780 CTTTTTTTTTTAATCATGAAGGG - Intergenic
1022534681 7:31089431-31089453 TTTTTTTTTTTAATCAGGAATGG + Intronic
1023749623 7:43359330-43359352 ATTCTGTTATTAAGGAGGAAAGG + Intronic
1024382558 7:48714958-48714980 CATTTATTTTTAATGAGGAAAGG - Intergenic
1024770065 7:52712344-52712366 CTCTCCTTCTTAATTAGGAAGGG - Intergenic
1025815479 7:64907172-64907194 TGTTTGTTTTTAATGAGAAAAGG + Intronic
1026371555 7:69704871-69704893 CTTTTTTTCTTTTTGAGGCAGGG + Intronic
1026685993 7:72510626-72510648 TTTTTTTTCTAAATGGGGAATGG + Intergenic
1027481342 7:78701370-78701392 GTTTTGTTCAAAATGTGGAAAGG + Intronic
1027562723 7:79752299-79752321 CTATTATTCTAACTGAGGAATGG - Intergenic
1027648636 7:80837000-80837022 TTTTTGTTCTAAATGGGAAAGGG - Intronic
1028004383 7:85544571-85544593 CTTTTTTTTTTAATCAGAAATGG - Intergenic
1028078506 7:86545238-86545260 CTTTTTTTACTAAAGAGGAATGG + Intergenic
1028299949 7:89185870-89185892 CTTTTTTTCTTATTGAGACAGGG - Intronic
1030999843 7:116402096-116402118 CTTTTTTTCTTATTAAAGAATGG + Intronic
1031383331 7:121115046-121115068 CTTCTGTTCTTTATGAGCAGGGG + Intronic
1031897556 7:127368988-127369010 GTTTTCTTCTTAAAGAGTAAAGG + Intronic
1032365903 7:131299534-131299556 CTTTTTTTCTAAATGGGAAAAGG - Intronic
1032631412 7:133657034-133657056 TTTTTGTTCTTAGTCTGGAAAGG + Intronic
1033789939 7:144779403-144779425 GTTTTGTTTTTAATAAAGAATGG + Intronic
1034205729 7:149313152-149313174 GTTTTTTTTTTAATGGGGAAAGG - Intergenic
1034370906 7:150595489-150595511 GTTTTGTTAGTAAGGAGGAAAGG - Intergenic
1034853755 7:154521150-154521172 CTTTTGTTCGTTATCAGGAAAGG + Intronic
1035067189 7:156115236-156115258 CTTTTCATTTTAATCAGGAATGG - Intergenic
1036541622 8:9719212-9719234 CTGTTGTACTTACTCAGGAAAGG - Intronic
1036564423 8:9926205-9926227 CTTTTTTTCTGAATATGGAATGG - Intergenic
1036688168 8:10925234-10925256 CTGTTGTTCTGGAGGAGGAAAGG + Intronic
1037659732 8:20916416-20916438 TTTCTGCTCTTAATGAGAAAAGG + Intergenic
1038108757 8:24469018-24469040 CATATGTTCTTAATGGGGAGGGG - Intronic
1039102984 8:33960263-33960285 TTTTTTTTCTAAATGAGAAACGG + Intergenic
1039246991 8:35620035-35620057 CTTTTATTCTGAATGAGGGAAGG - Intronic
1039449749 8:37662860-37662882 ATTTTTTTCTTAAAGAGGGAAGG - Intergenic
1039667089 8:39545036-39545058 CTTTTGTTCTTAATTAATATCGG + Intergenic
1039845350 8:41321758-41321780 CCATTGTTCTTAAAGAGGCAGGG - Intergenic
1044249051 8:89984827-89984849 TTTTCGTTCATAATCAGGAAAGG - Intronic
1044375961 8:91470917-91470939 CTTTTTTTTTTAATCAGAAAAGG - Intergenic
1044959528 8:97516730-97516752 TTTTTGTTTTTAATGAGGCTTGG - Intergenic
1045509227 8:102800943-102800965 CTTTTTTTTTTAATCATGAAAGG - Intergenic
1046172196 8:110525157-110525179 GTTTTGTATTGAATGAGGAATGG - Intergenic
1046434520 8:114169661-114169683 CTTTTGTTCTCAAATAAGAAGGG - Intergenic
1046509520 8:115184208-115184230 GTTTTGTTTTTAATGGGCAAAGG + Intergenic
1047086329 8:121520306-121520328 CTTTTTTTTTTAATCATGAATGG - Intergenic
1047676296 8:127206895-127206917 CATTTGGTCATAATGCGGAAAGG + Intergenic
1048256376 8:132908080-132908102 GTTTTGAGCTCAATGAGGAAGGG + Intronic
1048316404 8:133366151-133366173 CCATTGTTCTTCCTGAGGAATGG + Intergenic
1048415710 8:134225647-134225669 CTTTTGTACTCAAAGAGGCATGG - Intergenic
1050749337 9:8918904-8918926 TTTTTGTTTTTAATTAGGAATGG + Intronic
1050826790 9:9956200-9956222 TTTTTGTTCTTTATGGGGAAAGG + Intronic
1051211021 9:14743866-14743888 CTTTTTTTCTCCTTGAGGAAAGG - Intronic
1051471612 9:17448985-17449007 CTTTCTTTCCTATTGAGGAAAGG + Intronic
1051495806 9:17721605-17721627 CTTTTTTTCTTTAGGTGGAATGG - Intronic
1051947962 9:22595073-22595095 CCTTTGTTTTTAATCTGGAATGG - Intergenic
1051955249 9:22685123-22685145 CTGTTGCACTTAATGAGGCAAGG - Intergenic
1052608045 9:30731216-30731238 CTTTTCTTCTCAGTGAAGAAAGG - Intergenic
1052986473 9:34491604-34491626 CTTTGCTGCTAAATGAGGAAAGG - Intronic
1053668468 9:40335469-40335491 CTTTTTATCATAATGAAGAATGG - Intergenic
1053918267 9:42961766-42961788 CTTTTTATCATAATGAAGAATGG - Intergenic
1054379608 9:64475521-64475543 CTTTTTATCATAATGAAGAATGG - Intergenic
1054516143 9:66040824-66040846 CTTTTTATCATAATGAAGAATGG + Intergenic
1055768311 9:79689332-79689354 TTTTTTTTCTTAATCAGGCAGGG + Intronic
1056052850 9:82788335-82788357 CTTTTGTCAGTGATGAGGAAAGG - Intergenic
1056136348 9:83632895-83632917 TTTATGTTCATAATGAAGAAAGG - Intronic
1056319260 9:85421136-85421158 GTTCTGTTCTTAAAGAAGAAGGG + Intergenic
1057043072 9:91861576-91861598 TTTGTGTACTTAGTGAGGAAGGG - Intronic
1057435285 9:95034683-95034705 CTTGTGTTTTTAATAGGGAAAGG + Intronic
1057907863 9:98996096-98996118 CTTCTGTTATTAGTCAGGAAAGG + Intronic
1058407795 9:104696646-104696668 ATTTAGTTATTAATGAGAAAGGG - Intergenic
1058489075 9:105476090-105476112 CTTTTGTTCTTAATCTGTAATGG - Intronic
1058757947 9:108100996-108101018 CTTCTTTACTAAATGAGGAAAGG - Intergenic
1060122461 9:121006669-121006691 CTTTTTTTGTAAATGAAGAAGGG - Intronic
1060255339 9:122023749-122023771 TGTTTGTTTTTAATTAGGAATGG - Intronic
1060713461 9:125894790-125894812 CCTCTGTTTTTATTGAGGAAAGG + Intronic
1185821527 X:3209301-3209323 GGTTGGTTCTTAATGGGGAAGGG - Intergenic
1186058280 X:5674763-5674785 CTGTTTTTCTTAATGATAAATGG + Intergenic
1186401561 X:9265112-9265134 CTTTTGTTTTTAAAGAGACAGGG - Intergenic
1186455813 X:9708995-9709017 GTTTTTTTCTTAATGAAGTATGG + Intronic
1186868503 X:13745837-13745859 CATTTGTTCTTTATGTGTAAAGG + Intronic
1186899624 X:14039913-14039935 TTTTTTTTCTTAATGTAGAAGGG - Intergenic
1187677619 X:21733348-21733370 CTTCAGTTCCTAATGATGAATGG + Intronic
1188248357 X:27860638-27860660 TTTTTCTTCTTAATAGGGAAAGG - Intergenic
1188346434 X:29072210-29072232 TTTTTTTCCTTAATGAGTAAAGG - Intronic
1189314821 X:40047617-40047639 CAGTTGTTTTTAATGAGGAAAGG + Intergenic
1189458244 X:41213288-41213310 TTTTTGTTTTTAATGAGGTGAGG - Intronic
1189858508 X:45248149-45248171 CTTTTTTTCTGCTTGAGGAAAGG - Intergenic
1189933068 X:46035550-46035572 CTTTTGTCCTTGAAGAGTAATGG + Intergenic
1190089290 X:47423725-47423747 ATTTTTTTCTTAATGAGGTGGGG - Intergenic
1190525843 X:51328848-51328870 CTTTTTTTCAGAATTAGGAAGGG - Intergenic
1190543634 X:51502814-51502836 CTTTTTTTCAGAATTAGGAAGGG + Intergenic
1193241365 X:79174086-79174108 ATATTTTTCTTAAAGAGGAAGGG + Intergenic
1193563419 X:83047952-83047974 CATTTCTTCTTCTTGAGGAAAGG - Intergenic
1194238578 X:91415115-91415137 AATTTGTTTTCAATGAGGAAAGG + Intergenic
1194320888 X:92444736-92444758 TTTTTTTTTTTAATGATGAAGGG + Intronic
1194821825 X:98517737-98517759 CTTTTGTTCATAACGACAAAGGG + Intergenic
1194863585 X:99036247-99036269 TTTTTGTAGTAAATGAGGAATGG - Intergenic
1195112604 X:101662624-101662646 CTTTTTTTTTAAATTAGGAATGG + Intergenic
1195951825 X:110283546-110283568 ATGTTGTTGTTTATGAGGAATGG - Intronic
1195962781 X:110402845-110402867 CTTCTGTTCCTAATCATGAAAGG - Intronic
1197485238 X:127041462-127041484 CTTCTGATCTTTATGATGAATGG - Intergenic
1197490838 X:127115607-127115629 CTTTTGTGGTTTAGGAGGAAAGG + Intergenic
1197552753 X:127914742-127914764 CTTTTATTGTTTCTGAGGAAAGG - Intergenic
1198257128 X:134933618-134933640 CTTTTTTTCTAAACAAGGAAAGG + Intergenic
1198549208 X:137726990-137727012 CTTGTGATCATAATGAGGATGGG - Intergenic
1198786375 X:140292580-140292602 GTTTTGTTTTTAATTATGAATGG + Intergenic
1200629003 Y:5557868-5557890 ATTTTTTTTTTAATGATGAAGGG + Intronic
1201257378 Y:12122374-12122396 GGTTGGTTCTTAATGGGGAAGGG + Intergenic
1201519227 Y:14853837-14853859 CTTTTCTTTTTAATGAGAAATGG + Intergenic
1202035787 Y:20633560-20633582 CCTTTCTTCTTATTGAGGAGAGG - Intergenic