ID: 930819349

View in Genome Browser
Species Human (GRCh38)
Location 2:55629847-55629869
Sequence GGGAGTGAGTGGCAAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930819349_930819354 -10 Left 930819349 2:55629847-55629869 CCCTCCACTTGCCACTCACTCCC No data
Right 930819354 2:55629860-55629882 ACTCACTCCCCATTTTATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930819349 Original CRISPR GGGAGTGAGTGGCAAGTGGA GGG (reversed) Intergenic
No off target data available for this crispr