ID: 930822019

View in Genome Browser
Species Human (GRCh38)
Location 2:55655835-55655857
Sequence CAAGGTTAACAGAGAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 350}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930822019_930822023 20 Left 930822019 2:55655835-55655857 CCTTCCTCTCTCTGTTAACCTTG 0: 1
1: 0
2: 1
3: 30
4: 350
Right 930822023 2:55655878-55655900 AATAAAGAAACAAGCCAAACTGG 0: 1
1: 1
2: 2
3: 87
4: 962

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930822019 Original CRISPR CAAGGTTAACAGAGAGAGGA AGG (reversed) Intronic
900820633 1:4884712-4884734 GAAGTCAAACAGAGAGAGGAAGG + Intergenic
901264309 1:7898403-7898425 CAAGATGGACAGAGAGAGAAGGG + Intergenic
901269566 1:7941457-7941479 CATGGGTGACAGAGGGAGGAAGG + Intronic
901358109 1:8670152-8670174 TCAGGTTAACAGAGAGAGCAGGG - Intronic
901770228 1:11526443-11526465 CAAGGCTCAGAGAGGGAGGAAGG + Intronic
902936613 1:19769319-19769341 CAAGGAGAGCAGAGAGAGGAGGG - Intronic
903004779 1:20291536-20291558 GAAGGTTGAGAGAGGGAGGAAGG - Intronic
903325317 1:22565757-22565779 CAAGGTCTAGAGAGAGAGGCAGG + Intronic
904271272 1:29351704-29351726 CCAGATCAACAGAGAGGGGAGGG - Intergenic
905601512 1:39256191-39256213 AAAGGTTAGCAGAGATTGGAAGG + Intronic
909394130 1:75150637-75150659 CAAGATTATCAGAGAGACCAGGG + Intronic
910416790 1:87009685-87009707 CTAGGCTAAAGGAGAGAGGAAGG + Intronic
911149999 1:94589452-94589474 CAAGCTTGCCTGAGAGAGGAAGG - Intergenic
911472776 1:98338795-98338817 TAAGATTATCAGCGAGAGGATGG - Intergenic
914735986 1:150417116-150417138 CAAGGTTAGTAGAAAGAGCATGG - Intronic
915042469 1:152980694-152980716 CAAGGTGATCAGAGAAAGGGAGG + Intergenic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
916165677 1:161965174-161965196 CAAAGTTAGCAGAGATTGGAGGG + Intergenic
916982708 1:170155359-170155381 AAAGGAAAAAAGAGAGAGGAAGG - Intronic
917683736 1:177394806-177394828 AAAGGTTACCAGAGGGAGGTAGG + Intergenic
919169006 1:193930436-193930458 ACAGGTTAAGAGAGAGAGAAAGG - Intergenic
922889958 1:229054169-229054191 GAAGGTTGATACAGAGAGGAAGG + Intergenic
922894342 1:229088771-229088793 CAAGGTAAGGAGAAAGAGGAGGG + Intergenic
923673228 1:236059167-236059189 CAAGTGTAACAGAAAGAGCACGG - Intronic
924010986 1:239665089-239665111 AAAGGACAAGAGAGAGAGGATGG - Intronic
924081183 1:240400113-240400135 GAAGTTTAACAGAGAGATCAAGG + Intronic
924919203 1:248609216-248609238 CAAGGTTTACAGAAAAATGATGG - Intergenic
1063914959 10:10872103-10872125 GAAGGTTGAGGGAGAGAGGAAGG - Intergenic
1064666928 10:17662957-17662979 CAAAGTGAAGAGAGAGAGGAGGG - Intronic
1065895374 10:30158669-30158691 CAAGGTGGCCAGAGAGATGAAGG - Intergenic
1066109945 10:32186997-32187019 CAAGGTTTACTGGGAGAGGATGG - Intergenic
1066702102 10:38141243-38141265 CAATTTTAACATATAGAGGATGG + Intergenic
1067508731 10:46877671-46877693 AAAAGTCAACAGAGACAGGAGGG + Intergenic
1067567965 10:47351700-47351722 CCAGGGTCACAGAGAGTGGATGG - Intronic
1067653520 10:48174179-48174201 AAAAGTCAACAGAGACAGGAGGG - Intronic
1070050521 10:72884914-72884936 CAAAGATAACAGAGTGAGGGAGG - Intronic
1072263318 10:93702878-93702900 TAAGGTTACTAGAGAGAGGACGG - Intergenic
1072534291 10:96349350-96349372 CAAGCTTCACAAAGAAAGGATGG - Intronic
1072730687 10:97844261-97844283 CAGGGCAAACAGAGAGGGGATGG - Intergenic
1072950920 10:99846144-99846166 TATGGTTAAAAGATAGAGGAGGG + Intronic
1073634126 10:105179933-105179955 CAGGGTTAACAGTAAGGGGAAGG - Intronic
1077165607 11:1135062-1135084 TAAGGTTAAAAGTGAAAGGATGG + Intergenic
1077573248 11:3356799-3356821 AAAGGTTAAGAGAGGGAGAAGGG + Intronic
1077915078 11:6606240-6606262 CAAGGTTGGCTGAGATAGGAAGG + Intronic
1078136958 11:8659546-8659568 CAAGGATGCCAGAGAAAGGAAGG - Intronic
1078295477 11:10064568-10064590 AAAGGTTAAAAGAAAAAGGAGGG + Intronic
1078536921 11:12182768-12182790 CAAGGTGGACAGTGGGAGGAGGG - Intronic
1079264244 11:18914974-18914996 CAAGAGTAAGAGAGAGAGGGAGG + Intergenic
1079466466 11:20735694-20735716 TAAGGTTAAAAGAGAAAGGATGG + Intronic
1080566478 11:33514054-33514076 CAAGGTTACCTCAGAGAGAAAGG + Intergenic
1081019158 11:37921823-37921845 GAAGGTAAACAGAAAGAGGCAGG - Intergenic
1081134625 11:39424288-39424310 CAAAGGTAACAGACACAGGAAGG + Intergenic
1081287447 11:41288472-41288494 CTAGGTTAATAGAGAGTGGGTGG + Intronic
1081854150 11:46293454-46293476 CAAGGTTACCAGTGTCAGGAGGG + Intronic
1082887634 11:58104305-58104327 GAAGGATAAGAGAGAGAGAAAGG + Intronic
1082916010 11:58438213-58438235 CAAGGTTACCACAGAGCTGATGG - Intergenic
1083077842 11:60059536-60059558 GGAGATTATCAGAGAGAGGAGGG - Intronic
1084941005 11:72613364-72613386 CAAGGCCCAGAGAGAGAGGAGGG - Intronic
1085891862 11:80589133-80589155 CCCTGTTAACAGAGAAAGGAAGG - Intergenic
1086150910 11:83609662-83609684 CAAGGTTGGCAGAGAGATTAAGG - Intronic
1087023248 11:93624181-93624203 CATGGTTGAGAGGGAGAGGATGG + Intergenic
1087078918 11:94151223-94151245 GAAGGAAAATAGAGAGAGGAGGG - Intronic
1087878291 11:103385311-103385333 CATGATGAACAGAGAGAGAAAGG - Intronic
1089702884 11:120255863-120255885 CAAGGTCACCAGAGGGAGGAAGG - Intronic
1089909582 11:122083385-122083407 CCAGGTTAACAGAGAGGAGCAGG - Intergenic
1090461962 11:126899056-126899078 AAAGGTTAACAGAAGGTGGAAGG + Intronic
1090883850 11:130859129-130859151 CAAGGGTTACAGAGAGTGGGAGG + Intergenic
1091359956 11:134971306-134971328 GAGGTTTAACAGAGAGAGAATGG - Intergenic
1092184279 12:6467249-6467271 CTGGGTTAACAGGGAGAGGATGG + Intronic
1095525408 12:43119188-43119210 CAAATATAACAGACAGAGGAAGG - Intergenic
1097063030 12:56300141-56300163 CAAGGTGAGCAGCGAGGGGAGGG - Exonic
1099907261 12:88786408-88786430 CAATGTTACGAGAGACAGGAGGG + Intergenic
1100167632 12:91935523-91935545 CAAGGTTAACAGGAAGAGGTAGG + Intergenic
1100619104 12:96254859-96254881 CAGGGTAGACAGGGAGAGGAAGG + Intronic
1101102397 12:101407431-101407453 CAAGGGGAACCGAGAGAGGACGG + Intronic
1102974218 12:117194849-117194871 CAAAGAAAAGAGAGAGAGGAAGG - Intergenic
1103206537 12:119133911-119133933 CAAGGTTAGCAGACAGGGGAGGG + Intronic
1104193447 12:126506937-126506959 GCAGGTTAACAGAGAGATCAAGG - Intergenic
1105453409 13:20520171-20520193 CAAAGTTAAGAGAGAGAATATGG + Intronic
1105970028 13:25420287-25420309 GAAGGTTAATACAGACAGGAAGG + Intronic
1106913889 13:34490864-34490886 CCAGGTAAAGAGAAAGAGGAAGG - Intergenic
1107374436 13:39786554-39786576 CAAGGTTTGCAGAGAGAAAATGG + Intronic
1107725548 13:43295657-43295679 GAAAGATGACAGAGAGAGGAGGG - Intronic
1107796143 13:44053760-44053782 CCAGGTTAAGAAGGAGAGGAAGG + Intergenic
1108935394 13:55875403-55875425 CCAGTTTACCAGAGAGAAGAAGG - Intergenic
1109491189 13:63101659-63101681 CAAGGGTAAGAGAGAGAAGCGGG - Intergenic
1111111156 13:83711460-83711482 CAAGGGAAAAAGAGAGAAGAAGG + Intergenic
1111207422 13:85029340-85029362 CAAGGTTAAAACAAAAAGGAAGG + Intergenic
1111495232 13:89039415-89039437 AAAGGATAACTGAGAAAGGAAGG + Intergenic
1112022464 13:95383684-95383706 AGAGGGTAACAGAGAGAGAAAGG - Intergenic
1112057695 13:95705945-95705967 AAAGGTTTAGAGAGATAGGAAGG - Intronic
1112182810 13:97101891-97101913 TAAGGTTAAAAGAAAGAGTAGGG - Intergenic
1112194403 13:97210977-97210999 AAAGGGTAGCAGGGAGAGGAAGG + Intergenic
1112305248 13:98267654-98267676 CAAGGTCAACAGAAACACGACGG + Intronic
1112748409 13:102553625-102553647 AAAGGCTCACAGAGAGAGGTGGG - Intergenic
1113334501 13:109365169-109365191 CAAGCTGAACAGAGAGGAGACGG - Intergenic
1115174348 14:30545449-30545471 ATAGGTTAACAGTGAAAGGATGG - Intergenic
1116760843 14:49011673-49011695 GAACGTTAACAGAGAGTGAAAGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1116987160 14:51232621-51232643 AAAGTTTAACAGAGAGATCAAGG + Intergenic
1117528193 14:56632499-56632521 CAAGGTTTGAAGAGAGTGGAGGG - Intronic
1117732447 14:58736940-58736962 CAAGGTAATCAGAGAGAGACCGG + Intergenic
1118088990 14:62451372-62451394 ACAGGTTAAGAGAGAGAGAAAGG - Intergenic
1118166194 14:63339040-63339062 CAAGAGGAAGAGAGAGAGGAGGG + Intergenic
1118478777 14:66143367-66143389 CAAAGAAAACAGAGAGGGGATGG + Intergenic
1118859176 14:69648887-69648909 AAAGGATGGCAGAGAGAGGAGGG - Intronic
1118862081 14:69672281-69672303 GAAGGTGAGAAGAGAGAGGAGGG + Intronic
1119565916 14:75629424-75629446 CAAAGTTAAAGGAGAGAGGAAGG - Intronic
1120389870 14:83892431-83892453 AAAGATTAACAGAGAGTAGAGGG + Intergenic
1120746646 14:88158645-88158667 CAAGGTCTACACAGAGAGTATGG - Intergenic
1122139137 14:99651912-99651934 CACTGTTAACACAGAGAGGGTGG + Intronic
1122160356 14:99779860-99779882 CAATCTTCACAGTGAGAGGAAGG + Intronic
1122663035 14:103310674-103310696 CAATGATAACAGAGACAGGTTGG + Intergenic
1123887067 15:24736605-24736627 CAAGGAAAACAGAGATTGGAGGG - Intergenic
1124252108 15:28113591-28113613 GCCGGTGAACAGAGAGAGGAGGG + Exonic
1125921990 15:43530419-43530441 CAAAGTTAACAGGGAGAGGATGG + Exonic
1127158956 15:56160076-56160098 CAAGGTTAAAAAAGTGGGGAAGG + Intronic
1129151227 15:73689091-73689113 CAAGGAGAATAGGGAGAGGAAGG - Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1131277988 15:90998240-90998262 AAAGGTAAAGAGAGAGAGAAAGG + Intergenic
1131464935 15:92647331-92647353 CTAGGTAAACTGAGAAAGGATGG - Intronic
1131583119 15:93664648-93664670 CAGGGTTAGCAGTTAGAGGAGGG - Intergenic
1132012917 15:98291912-98291934 GAAGGTGGAAAGAGAGAGGAGGG + Intergenic
1133777298 16:8907028-8907050 CAAAATTAACAGAGGCAGGAAGG + Intronic
1133924094 16:10180433-10180455 CAAGGTGAAGAGTGAGAGGCAGG + Intronic
1134755439 16:16663318-16663340 GAGGATTAACAGAAAGAGGAAGG + Intergenic
1134990627 16:18695852-18695874 GAGGATTAACAGAAAGAGGAAGG - Intergenic
1137455560 16:48615232-48615254 CATGGTTGTCAGAGAGATGATGG - Intronic
1137695514 16:50459379-50459401 CAAGATTAACAAAAAGAGAAAGG - Intergenic
1138344735 16:56312956-56312978 CTAGGTCAACAAAGAGAGCAAGG + Intronic
1138811024 16:60150632-60150654 CAAGGCTAATAGAGAAAGCAAGG + Intergenic
1139072553 16:63401037-63401059 CAGGGTTAACTAAGAGTGGAAGG + Intergenic
1139145157 16:64314819-64314841 CAAAGATAATAGAGAGAGCAAGG + Intergenic
1140042739 16:71419773-71419795 CAGGGTAAACATACAGAGGAAGG + Intergenic
1140869879 16:79096520-79096542 CGAAGGTAACAGAGAAAGGATGG - Intronic
1141016660 16:80457252-80457274 TAAGGTTGAAAGAGAGAGAAAGG + Intergenic
1141297475 16:82783287-82783309 CAAGGCTAGCAGGGAGGGGAGGG + Intronic
1141462079 16:84183602-84183624 CAGGCTTAGCAGGGAGAGGAAGG + Intronic
1142911412 17:3096361-3096383 CAAGGTTGAAAGTAAGAGGATGG + Intergenic
1143260410 17:5594443-5594465 CAAGGCTAAGATAGGGAGGAGGG + Intronic
1143373173 17:6453059-6453081 AAAGGAAGACAGAGAGAGGAAGG - Exonic
1146130077 17:30265423-30265445 CAAGGGTAAAAGGTAGAGGAGGG - Intronic
1147370949 17:39992686-39992708 CAAGGCTAGAAGAGAGAGGAAGG - Intronic
1147499405 17:40948470-40948492 CAAAGGAAACAGAGAGAGGGAGG - Intergenic
1148063625 17:44853177-44853199 CGGGGTTTCCAGAGAGAGGAGGG + Intronic
1148835797 17:50465165-50465187 CCATTTTTACAGAGAGAGGAGGG - Intronic
1149067492 17:52497559-52497581 CATGAGTAACAGAGAGAGGGAGG + Intergenic
1149393255 17:56213521-56213543 CAAGGAAAACAGAGGGAGGCAGG + Intronic
1149989344 17:61372754-61372776 GGGGGGTAACAGAGAGAGGAGGG - Intronic
1150750085 17:67853362-67853384 CAAGGTGAAGACAGAAAGGAAGG - Intronic
1150862492 17:68815798-68815820 CAAGGTTAGAGTAGAGAGGAAGG - Intergenic
1151162970 17:72181386-72181408 CAAGGTAAACGGGAAGAGGATGG - Intergenic
1151535123 17:74734888-74734910 AAAGGGAAAGAGAGAGAGGAAGG + Intronic
1153349553 18:4063730-4063752 ACAGGTTAAGAGAGAAAGGAAGG - Intronic
1153752535 18:8247976-8247998 CAGGGATAGCAGAGAGAGGGCGG - Intronic
1153948583 18:10038108-10038130 CAAGGGCATCAGAGAGAGCAAGG + Intergenic
1153982197 18:10320106-10320128 CAAGGTTAGCAGAGAGGCCAGGG + Intergenic
1154495156 18:14950703-14950725 GAGGTTTAACAGAGAGAGAATGG + Intergenic
1157830484 18:50852718-50852740 CAAGTTTGACAGAGAGAGGGAGG - Intergenic
1157869966 18:51220960-51220982 CAAGGTGAAGAGAGAGAGAGAGG + Intergenic
1157951058 18:52037643-52037665 AAAGGAAAAGAGAGAGAGGAAGG + Intergenic
1158148024 18:54337925-54337947 GAAGTTTAACAGAGAGAAGCAGG + Intronic
1159202202 18:65201981-65202003 AAAGGTTCACAGGGAGAGGCAGG - Intergenic
1161267895 19:3373424-3373446 CAAGGGGGAAAGAGAGAGGAGGG - Intronic
1161458408 19:4381556-4381578 CAGGGGGAACAGAGAGAGGCAGG - Intronic
1161458413 19:4381575-4381597 CAGGGTAGACAGAGAGAGGCAGG - Intronic
1161730078 19:5954526-5954548 CAATGCTAACAGAGAGGGCAGGG + Intronic
1162877813 19:13633905-13633927 GAAGGAAAAGAGAGAGAGGAAGG - Intergenic
1163451376 19:17379285-17379307 CCAGGGTAACAGAGTGGGGAGGG + Intergenic
1164838889 19:31377522-31377544 CAAGGTTAACCCAGGAAGGAAGG - Intergenic
1164946912 19:32303209-32303231 CAAGGAAAAGAGAGAGAGAAAGG - Intergenic
1165163745 19:33835226-33835248 CAAGATTGACAGAGAGAAAAAGG + Intergenic
1166226898 19:41401599-41401621 CTATGATAACAGAGACAGGAAGG - Intronic
1166557062 19:43707289-43707311 GAAGGTTCAGAGAGAGAGGGTGG - Intergenic
1166657455 19:44622772-44622794 CAAGGTGGGCATAGAGAGGAGGG - Intronic
1168090523 19:54080045-54080067 GAAGGGAAAGAGAGAGAGGAAGG + Intronic
1168496030 19:56852209-56852231 CTAGGTTAACAGGCAGAGGTTGG + Intergenic
926909356 2:17836047-17836069 CCATGTTAACACAGTGAGGAAGG - Intergenic
926909362 2:17836093-17836115 CCATGTTAACACAGTGAGGAAGG + Intergenic
928688702 2:33776318-33776340 CAAGGTTTCCACAGTGAGGAAGG - Intergenic
929120648 2:38481372-38481394 CAAGAAAAACAGATAGAGGAAGG + Intergenic
930822019 2:55655835-55655857 CAAGGTTAACAGAGAGAGGAAGG - Intronic
931286432 2:60835775-60835797 GAAGGGTAACAGGGAAAGGATGG + Intergenic
931958551 2:67455820-67455842 AAAGGTGGAGAGAGAGAGGATGG + Intergenic
932179304 2:69631522-69631544 CAAGGTTAACACAGAGCCCAAGG + Intronic
932291315 2:70582452-70582474 CAAGATTAAGAGAGAGATGGGGG + Intergenic
933628830 2:84633427-84633449 AAGGGAGAACAGAGAGAGGAAGG + Intronic
934474009 2:94580735-94580757 CAATGTTGACACAGAGAGAAGGG - Intergenic
936444955 2:112587917-112587939 CAAGGAGACCAGAGAGAGGCTGG - Intronic
936577341 2:113667772-113667794 GAAGGTGAGCAGAGAGAGGGTGG + Intergenic
936909744 2:117577853-117577875 AAAGGATAACAGAGAGAGAAAGG + Intergenic
937808641 2:126174910-126174932 CATGTTGAACAGAGAGAGAAGGG - Intergenic
938164087 2:129011060-129011082 CAAGGATGAGAGAGAGAGGGAGG + Intergenic
938232741 2:129675578-129675600 CCCAGTGAACAGAGAGAGGAAGG - Intergenic
938928635 2:136066747-136066769 CAAGATTCACAGATGGAGGATGG + Intergenic
940157061 2:150668580-150668602 CAAGATTAACCAAGAAAGGAAGG + Intergenic
943400770 2:187407932-187407954 CAAAGTTAACATATAGAGGTGGG - Intronic
943425010 2:187720485-187720507 CAGGGTTAAGAGTGACAGGAGGG - Intergenic
943919152 2:193679978-193680000 CAAGGGAAACAGAGAAAGGAAGG + Intergenic
944896130 2:204166797-204166819 AAAGGTGAACACAGAGAGAAAGG - Intergenic
945004045 2:205384148-205384170 TAAGTTTGACAGAGAGAGAATGG + Intronic
946435226 2:219647230-219647252 CAGGGGTAAGAGAGAGAGGGGGG - Intergenic
947194648 2:227548992-227549014 AAAGGTTAACTGAGGGAGAAGGG - Intronic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
1168874411 20:1160917-1160939 CAAGGCCAACAGAAAGAAGATGG + Intronic
1169343785 20:4814688-4814710 CAAGGTTAAAGGAGGGTGGAGGG - Intronic
1169535663 20:6537320-6537342 ATAGCTTAACAGAGAGAGCAGGG - Intergenic
1169723385 20:8703000-8703022 AGAGGTGGACAGAGAGAGGAGGG + Intronic
1170351246 20:15444070-15444092 CAAGGTTGAGAGAGAGGGGACGG - Intronic
1170679221 20:18510054-18510076 CAAAGTTAACAAAGTGCGGAAGG + Intronic
1172452091 20:35033434-35033456 AAAGCTTAACAGAGAGATCATGG - Intronic
1173164264 20:40675410-40675432 CCATGTCAACAGAGAAAGGAAGG + Intergenic
1173450008 20:43155524-43155546 GATGGTTAGCAGGGAGAGGATGG + Intronic
1174188552 20:48723720-48723742 CCAGGAGAACAGAGAGAGCAGGG - Intronic
1174399168 20:50266805-50266827 CAAGGCTAAGAGAGTCAGGATGG + Intergenic
1174763052 20:53225450-53225472 GAAGGTTAACGGAGATTGGAAGG + Intronic
1175705774 20:61175371-61175393 AGAGGTGAACAGAGTGAGGATGG - Intergenic
1176515648 21:7781500-7781522 CAAGGTGCAGAGAGAGAGGGGGG + Intergenic
1177498017 21:21914243-21914265 AAAGGATAAGAGAGAGAGAAGGG + Intergenic
1178649676 21:34411512-34411534 CAAGGTGCAGAGAGAGAGGGGGG + Intergenic
1178912244 21:36684491-36684513 GACTGCTAACAGAGAGAGGAAGG - Intergenic
1178923147 21:36753002-36753024 TAAGTTCAACAGAGATAGGAGGG + Exonic
1180122277 21:45761804-45761826 CAAGGCTGGCAGAGAGGGGAAGG - Intronic
1181395485 22:22618387-22618409 CAAGGGACACAGAGAGGGGAGGG - Intergenic
1181410024 22:22712234-22712256 CAAAGGAAACAGAGAGAGGAGGG - Intergenic
1183977319 22:41520131-41520153 CAAGGAGAAGAAAGAGAGGAGGG - Intronic
1184108417 22:42381782-42381804 CAAGGTAAGCAGAGAGGTGAGGG - Exonic
1184936497 22:47727462-47727484 CAAGGTCAAAAGGGAGAGGGGGG - Intergenic
949431905 3:3985865-3985887 CCATGTTAGCAGAGAGAGAAAGG - Intronic
949749086 3:7330391-7330413 CAAGGGGGACAGAGAGAAGAGGG - Intronic
949763435 3:7498851-7498873 CAAGGACAACAGAAAGTGGAGGG - Intronic
949808751 3:7983560-7983582 CAATGAAAACAGAGAGAGGCTGG + Intergenic
951370923 3:21846715-21846737 CTAGCTTTAGAGAGAGAGGATGG + Intronic
951787907 3:26443180-26443202 GAAGGTTAACAAATTGAGGAGGG - Intergenic
952333443 3:32385285-32385307 AAAGTTTTACTGAGAGAGGAAGG - Intergenic
952430354 3:33218199-33218221 CGAGGCTAAGAGAGAGAGAATGG - Intronic
953910316 3:46889515-46889537 CAAGAGTCACAGAAAGAGGAGGG - Intronic
954611936 3:51949111-51949133 CAAGGCTAACAGGGATTGGAGGG - Intergenic
955411095 3:58655989-58656011 AAAAGTGAACAGATAGAGGATGG - Intronic
955560928 3:60189933-60189955 CAAGTTTCAAAGAGAGAAGAAGG + Intronic
958068388 3:88575911-88575933 CAAGATTTACAAAGAGAGAAGGG + Intergenic
959582779 3:107999264-107999286 GGAGGTTTGCAGAGAGAGGAAGG + Intergenic
960779798 3:121306977-121306999 ACAGGTTAACAGAGAGATGAAGG + Intronic
962033400 3:131625089-131625111 CAAGGTGCAAAGAGAGAGAAAGG - Intronic
962996967 3:140639339-140639361 CAAGGTAAACAAAGAGCAGAAGG - Intergenic
963805895 3:149722619-149722641 GAAGGTGAACAGAGAGAGAAAGG - Intronic
965877836 3:173349838-173349860 GAAGGTTAAGAGAGAGACAAAGG - Intergenic
965954212 3:174348668-174348690 GAAGGAAAAGAGAGAGAGGAAGG + Intergenic
966924946 3:184638610-184638632 GAAGGTGAGCAGAGAGAGGTTGG + Intronic
967198540 3:187050615-187050637 GAAGGAAAAGAGAGAGAGGAAGG + Intronic
969047364 4:4346116-4346138 TAAAGTCATCAGAGAGAGGACGG - Intergenic
970088193 4:12371467-12371489 CAAGAGGAACAGAGAGAGTAGGG - Intergenic
970886648 4:20994021-20994043 CAAGGATAAAAGAAAGAGGGAGG - Intronic
971500002 4:27308430-27308452 CAAGGAAAACTGAGACAGGAAGG - Intergenic
972337337 4:38118792-38118814 CAAGGTTAACAGCGGGGGCACGG - Intronic
973188029 4:47354075-47354097 CTAGGCTAAAAGAGAGAAGATGG - Intronic
973199105 4:47479565-47479587 CAAGATTCACAGAGAAAGGAGGG + Intergenic
974074317 4:57154900-57154922 AAAGGGAAAGAGAGAGAGGAGGG - Intergenic
974144835 4:57934331-57934353 CACAGTTAACAGAGAGTGGCTGG + Intergenic
974803311 4:66847332-66847354 TGAGGTTAAAAGAGAGAGAAAGG - Intergenic
975640814 4:76498341-76498363 ATAGATTAACAGAGAGAGGGAGG + Intronic
976465626 4:85365560-85365582 CCAGATTCACAGAGAGAGGCAGG + Intergenic
976618299 4:87100530-87100552 AAAGGATAAAAGAGAAAGGATGG - Intronic
977796953 4:101177491-101177513 CAAGCTTAACAGGAAAAGGAGGG - Intronic
979132154 4:117060557-117060579 GAAGGTAAACAGAGTGATGAAGG - Intergenic
980156259 4:129110661-129110683 GAAGGCAAACAGGGAGAGGAAGG - Intronic
981110453 4:140928359-140928381 CATGGTTTACATAGAGGGGAAGG + Intronic
981742336 4:148015841-148015863 CTAAGTTAACATAGAAAGGAGGG - Intronic
982542762 4:156695096-156695118 AAAGGTGAACAGAGACAGGCAGG + Intergenic
983468091 4:168120616-168120638 CAACGTTGACAGGGAGAAGAGGG + Intronic
984451222 4:179905562-179905584 AGAGAATAACAGAGAGAGGAGGG + Intergenic
985112482 4:186560222-186560244 CAAGAGGAAGAGAGAGAGGAGGG + Intergenic
987729606 5:21752017-21752039 CGAGGTAAACAGAGAGAGTCTGG + Exonic
987982515 5:25104735-25104757 CAAGGTAAACACAGAGAGTCAGG + Intergenic
989715172 5:44454410-44454432 CAGTTTTAACAGAGAGAGGGAGG + Intergenic
990222149 5:53604711-53604733 CAAGATAAACCTAGAGAGGAAGG - Intronic
990625751 5:57608654-57608676 GAAGGAGAACAGAGAGAGAAAGG + Intergenic
992167872 5:74072917-74072939 TAAGTTTACCAGAGAGAAGAAGG - Intergenic
992344381 5:75861815-75861837 GAAGGGGAAGAGAGAGAGGAGGG + Intergenic
993604454 5:89971253-89971275 CCAGTGTAATAGAGAGAGGAAGG + Intergenic
993685394 5:90931072-90931094 ATAGGTGAAGAGAGAGAGGAGGG + Intronic
995333624 5:110974360-110974382 CAAAGGTAACAGATAGAAGAGGG - Intergenic
997029245 5:130104566-130104588 TTAGGTAAACAGAGAGAAGAAGG + Intronic
997739092 5:136238075-136238097 CCAGGTACAGAGAGAGAGGAAGG - Intronic
1000359248 5:160432484-160432506 CAAGGTTTCCAGAGAGAGAGTGG + Intergenic
1000391352 5:160726621-160726643 AAAGGGAAACAGAGAGAGCAAGG + Intronic
1001685675 5:173593175-173593197 CAAGGCTCACAGTGAGTGGATGG - Intergenic
1002820404 6:719389-719411 CAAGGTTAAATGAGATTGGAAGG + Intergenic
1003016031 6:2468213-2468235 GAGGGTAGACAGAGAGAGGAAGG + Intergenic
1003756646 6:9128462-9128484 CAGGATCAAGAGAGAGAGGAGGG - Intergenic
1004033203 6:11893964-11893986 GAAGCTTAACAGAGAGATCATGG - Intergenic
1004486886 6:16074518-16074540 CAAGATTAGAGGAGAGAGGAAGG + Intergenic
1007730751 6:43944122-43944144 CATGGAGAGCAGAGAGAGGAAGG - Intergenic
1008219529 6:48838564-48838586 ACAGGTTAAGAGAGAGAGAAAGG + Intergenic
1011507445 6:88061949-88061971 CAATGTTAGCTGAGAGAGGGTGG - Intronic
1013237340 6:108208845-108208867 CAAGGTTAACCAGGAGAGGATGG - Intergenic
1013828580 6:114245304-114245326 GAAGGTTTAGAGAGATAGGACGG + Intronic
1015021011 6:128475009-128475031 CAAAGTGAACCAAGAGAGGATGG - Intronic
1015374857 6:132498977-132498999 CAAGGTCATCAGATAGAGAATGG - Intronic
1015840470 6:137471534-137471556 CAAGAATGACAGAGAAAGGACGG - Intergenic
1017105266 6:150881609-150881631 AAAGGCTAACAGAGTGATGATGG - Intronic
1017686517 6:156918869-156918891 AAAAGGGAACAGAGAGAGGAAGG - Intronic
1017823017 6:158062315-158062337 CAAGGGTAACTGAGTGGGGAGGG - Intronic
1018593635 6:165454577-165454599 CACGCTTTAGAGAGAGAGGAAGG - Intronic
1018724818 6:166603702-166603724 CAAAGTTAACAGGCACAGGAAGG + Intronic
1019937799 7:4267766-4267788 CAAGGTTTACTAAGAGTGGAGGG - Exonic
1020224538 7:6269752-6269774 CAAGATAAGGAGAGAGAGGATGG - Intronic
1021522428 7:21551195-21551217 CTAGTTTACCAGAGAGAAGAAGG - Intronic
1021638684 7:22716992-22717014 CAAGGGAAACAGAGAGGAGAAGG - Intergenic
1022081068 7:27021866-27021888 CTAGCTGAAGAGAGAGAGGAGGG + Intergenic
1022558124 7:31320896-31320918 CATGATTGACAGAGAGATGAAGG + Intergenic
1023357027 7:39377635-39377657 CAAGGTTGACACAGCGAGGGGGG - Intronic
1023659446 7:42457431-42457453 AAAGGTTAACAGAGTGTGCATGG - Intergenic
1023915468 7:44585448-44585470 CAAAGTAACCAGAGAGATGAGGG - Intergenic
1024120504 7:46232904-46232926 CAAAGTTAAAAGGGACAGGAAGG + Intergenic
1024489653 7:49965327-49965349 CAAAGTGAAAAGACAGAGGAGGG + Intronic
1024571172 7:50723852-50723874 CAAGGCAAACAGACATAGGAAGG + Intronic
1029308881 7:99642917-99642939 CAAGTTGAACAGAGACAGTATGG + Intergenic
1029444562 7:100604921-100604943 GCAGGTTAACAGAGAGCGGCCGG - Intronic
1030840462 7:114346764-114346786 AAAGGTTATCAGAGACTGGATGG + Intronic
1030983420 7:116211666-116211688 GAAGTTTTGCAGAGAGAGGAAGG + Intronic
1031485042 7:122315370-122315392 CAAGCGGAACAGAGAGAGAAAGG - Intergenic
1034399279 7:150851324-150851346 CAAAGTTAATGGAGTGAGGATGG - Intronic
1034752505 7:153584025-153584047 CAAGGTCAGCAGGGAGAGAAGGG + Intergenic
1034929196 7:155147905-155147927 CAGGGGGAAGAGAGAGAGGAGGG - Intergenic
1035275403 7:157745327-157745349 CAATGTTTACAGTGAGAGGGTGG - Intronic
1035814502 8:2524771-2524793 CAAGGATAACAAAGAGAAGTAGG - Intergenic
1037384690 8:18325937-18325959 CAAAGGTGACAGAGAGAAGATGG - Intergenic
1037391139 8:18392833-18392855 ACAGGTTAAGAGAGAGAGGAAGG + Intronic
1037903575 8:22702571-22702593 CAAAGTTAACATAAAGAGGAGGG - Intergenic
1039323685 8:36461631-36461653 CCAGTTTAACAGAGAGAGCCAGG + Intergenic
1039447785 8:37646474-37646496 CAGGGGCAAGAGAGAGAGGAGGG + Intergenic
1040667023 8:49646170-49646192 CAAGGTTTTCAGAGAGAGGGTGG - Intergenic
1040980822 8:53244761-53244783 TAAGGAGAACAGAAAGAGGATGG + Intronic
1042454842 8:68989200-68989222 CAAGGCGAACAGGAAGAGGAAGG + Intergenic
1044034796 8:87287384-87287406 CACAGATAACAGAGAGAGGATGG + Intronic
1045041790 8:98231418-98231440 GGAGATTAACAGTGAGAGGAGGG - Intronic
1045214735 8:100136671-100136693 CCAGGTGAACACAGAGAAGAGGG - Intronic
1046877047 8:119266668-119266690 CAAGGACAGCAGGGAGAGGAAGG + Intergenic
1049514388 8:143045693-143045715 CAGGCTTGCCAGAGAGAGGAAGG + Intronic
1050770096 9:9187603-9187625 CAAGGTTGAGAGAGAGAGAGAGG - Intronic
1051347300 9:16163768-16163790 CAGGGTGTAAAGAGAGAGGAAGG - Intergenic
1053430731 9:38040297-38040319 CAAGGGTAAGACAGAGATGATGG + Intronic
1053684067 9:40505397-40505419 CAATGTTGACACAGAGAGAAGGG + Intergenic
1053836701 9:42144500-42144522 CAATGATAAAAGAGAAAGGAAGG + Intergenic
1053934041 9:43133682-43133704 CAATGTTGACACAGAGAGAAGGG + Intergenic
1054279654 9:63119556-63119578 CAATGTTGACACAGAGAGAAGGG - Intergenic
1054297162 9:63340861-63340883 CAATGTTGACACAGAGAGAAGGG + Intergenic
1054395182 9:64645369-64645391 CAATGTTGACACAGAGAGAAGGG + Intergenic
1054429829 9:65150569-65150591 CAATGTTGACACAGAGAGAAGGG + Intergenic
1054500554 9:65870963-65870985 CAATGTTGACACAGAGAGAAGGG - Intergenic
1056402539 9:86242019-86242041 GAAGGTTATCAGAGAGATCAGGG + Intronic
1056545050 9:87606456-87606478 GAAGGGAAAGAGAGAGAGGAAGG - Intronic
1056689726 9:88797665-88797687 CAATCTTAACAGAGAGAATATGG - Intergenic
1057302062 9:93892309-93892331 CAAGGTACCCAAAGAGAGGAGGG + Intergenic
1058808552 9:108617015-108617037 CAAGTTTAAGTGAGAGAAGAAGG - Intergenic
1059081671 9:111256653-111256675 CTATGTTGAGAGAGAGAGGATGG - Intergenic
1059316921 9:113433768-113433790 AGAGATTAAAAGAGAGAGGAAGG - Intergenic
1059670448 9:116485958-116485980 CAAGGTTCACAGATTGTGGAAGG + Intronic
1060057343 9:120426140-120426162 CATGGTTAACAGAGTGATGCAGG - Intronic
1061848797 9:133402807-133402829 CAAGGACAACAGAGGCAGGAAGG + Intronic
1062315292 9:135964231-135964253 CTGGGGGAACAGAGAGAGGAGGG + Intergenic
1062484926 9:136769981-136770003 CAGGGCAAAGAGAGAGAGGAAGG - Intergenic
1062728672 9:138096211-138096233 CAATGTGATCACAGAGAGGAAGG + Intronic
1186650954 X:11559459-11559481 TAAGGGTAACAGAGATATGAAGG - Intronic
1187106805 X:16251713-16251735 GAAGGTTTGCAGAGAGAAGAGGG + Intergenic
1187292735 X:17970635-17970657 CATGGTTTGCAGAGAGAGTAGGG - Intergenic
1188958586 X:36463743-36463765 CAAGCTAAACAGAGAATGGAAGG + Intergenic
1189909989 X:45801061-45801083 CACGGTTAACAGAGAAAGCTGGG + Intergenic
1190739490 X:53279980-53280002 CAAAGTCAAGAAAGAGAGGACGG + Intronic
1191791868 X:64979550-64979572 CCAGGCTAGCAGTGAGAGGAAGG + Intronic
1192667523 X:73102891-73102913 CAAGAGGAAGAGAGAGAGGAGGG - Intergenic
1194365053 X:93004590-93004612 CAAGGCCAAGAGAGAGAGGAGGG - Intergenic
1194418231 X:93638920-93638942 CAAAATGAAGAGAGAGAGGAGGG - Intergenic
1195087403 X:101425368-101425390 TGTGGTTAGCAGAGAGAGGAAGG + Intronic
1195299118 X:103509579-103509601 GAAGGAGAAAAGAGAGAGGAAGG - Intronic
1196295958 X:113997808-113997830 ACAGGTTAAGAGAGAGAGAAAGG + Intergenic
1196861380 X:120031644-120031666 CAAGGTTTACAGAAGGAGGGAGG + Intergenic
1198562980 X:137871405-137871427 CCAGGGATACAGAGAGAGGATGG - Intergenic
1199148285 X:144397413-144397435 CATAGTTAACAGAGATAGGAAGG - Intergenic
1200367639 X:155684169-155684191 GAAGGTTAAGGGAGAGAGGAGGG + Intergenic
1200673281 Y:6120850-6120872 CAAGGCCAAGAGAGAGAGGAGGG - Intergenic