ID: 930825534

View in Genome Browser
Species Human (GRCh38)
Location 2:55693386-55693408
Sequence TTCCGATCTCTTTACTTTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 184}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930825534_930825540 4 Left 930825534 2:55693386-55693408 CCCGGAAAGTAAAGAGATCGGAA 0: 1
1: 0
2: 0
3: 21
4: 184
Right 930825540 2:55693413-55693435 GGTGGACGGACAGAGTCGGATGG 0: 1
1: 0
2: 0
3: 17
4: 115
930825534_930825541 19 Left 930825534 2:55693386-55693408 CCCGGAAAGTAAAGAGATCGGAA 0: 1
1: 0
2: 0
3: 21
4: 184
Right 930825541 2:55693428-55693450 TCGGATGGAGCAAAGAAGCCCGG 0: 1
1: 0
2: 0
3: 10
4: 128
930825534_930825539 0 Left 930825534 2:55693386-55693408 CCCGGAAAGTAAAGAGATCGGAA 0: 1
1: 0
2: 0
3: 21
4: 184
Right 930825539 2:55693409-55693431 GTCAGGTGGACGGACAGAGTCGG 0: 1
1: 0
2: 0
3: 18
4: 127
930825534_930825538 -10 Left 930825534 2:55693386-55693408 CCCGGAAAGTAAAGAGATCGGAA 0: 1
1: 0
2: 0
3: 21
4: 184
Right 930825538 2:55693399-55693421 GAGATCGGAAGTCAGGTGGACGG 0: 1
1: 0
2: 3
3: 4
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930825534 Original CRISPR TTCCGATCTCTTTACTTTCC GGG (reversed) Intronic