ID: 930828963

View in Genome Browser
Species Human (GRCh38)
Location 2:55723160-55723182
Sequence GTGTCTATAGAAGAGCATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930828963_930828965 21 Left 930828963 2:55723160-55723182 CCTGGATGCTCTTCTATAGACAC No data
Right 930828965 2:55723204-55723226 CAATATGATTTTATGTATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930828963 Original CRISPR GTGTCTATAGAAGAGCATCC AGG (reversed) Intergenic
No off target data available for this crispr