ID: 930832199

View in Genome Browser
Species Human (GRCh38)
Location 2:55757061-55757083
Sequence TATTCCACCATAATGGGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930832194_930832199 20 Left 930832194 2:55757018-55757040 CCAATGGATCTTCCATATTTTTT No data
Right 930832199 2:55757061-55757083 TATTCCACCATAATGGGTTCTGG No data
930832195_930832199 8 Left 930832195 2:55757030-55757052 CCATATTTTTTATAATGTGTTTG No data
Right 930832199 2:55757061-55757083 TATTCCACCATAATGGGTTCTGG No data
930832193_930832199 21 Left 930832193 2:55757017-55757039 CCCAATGGATCTTCCATATTTTT No data
Right 930832199 2:55757061-55757083 TATTCCACCATAATGGGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930832199 Original CRISPR TATTCCACCATAATGGGTTC TGG Intergenic
No off target data available for this crispr