ID: 930833695

View in Genome Browser
Species Human (GRCh38)
Location 2:55772997-55773019
Sequence GGTCATGGGACAATAGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2389
Summary {0: 1, 1: 324, 2: 1349, 3: 513, 4: 202}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930833695 Original CRISPR GGTCATGGGACAATAGTGAA GGG Intergenic
Too many off-targets to display for this crispr