ID: 930835794

View in Genome Browser
Species Human (GRCh38)
Location 2:55792289-55792311
Sequence GGAGCTCTTTTAGGGAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930835786_930835794 12 Left 930835786 2:55792254-55792276 CCGGTTGTTCGTTTCCATGTTTA No data
Right 930835794 2:55792289-55792311 GGAGCTCTTTTAGGGAGGCCTGG No data
930835787_930835794 -2 Left 930835787 2:55792268-55792290 CCATGTTTAGTGCTCCCTTCAGG 0: 30
1: 4722
2: 4245
3: 2184
4: 1247
Right 930835794 2:55792289-55792311 GGAGCTCTTTTAGGGAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930835794 Original CRISPR GGAGCTCTTTTAGGGAGGCC TGG Intergenic
No off target data available for this crispr