ID: 930843528

View in Genome Browser
Species Human (GRCh38)
Location 2:55875617-55875639
Sequence ATGAATTGGCTTGTGGTTGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930843525_930843528 -6 Left 930843525 2:55875600-55875622 CCTAACTACACTACTGAATGAAT 0: 1
1: 0
2: 0
3: 30
4: 238
Right 930843528 2:55875617-55875639 ATGAATTGGCTTGTGGTTGACGG 0: 1
1: 0
2: 3
3: 14
4: 146
930843524_930843528 0 Left 930843524 2:55875594-55875616 CCTGGACCTAACTACACTACTGA 0: 1
1: 0
2: 1
3: 6
4: 46
Right 930843528 2:55875617-55875639 ATGAATTGGCTTGTGGTTGACGG 0: 1
1: 0
2: 3
3: 14
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930843528 Original CRISPR ATGAATTGGCTTGTGGTTGA CGG Intronic
903739691 1:25551683-25551705 TGGAATAGGCTTGTGGTTGATGG + Intronic
907674657 1:56507360-56507382 ATGAATTAGCTTGTGGCTTCAGG - Intronic
909311438 1:74154964-74154986 ATATATTGGCTTGTGCTGGAAGG + Intronic
910429353 1:87146045-87146067 ATGAATTGGCTTGTGCTTGTAGG + Intronic
911889740 1:103353186-103353208 ATGAATTGGAATGTAGTTGGTGG - Intergenic
912185696 1:107273327-107273349 ATGTATTGGCTTGTGAATTAAGG + Intronic
912256950 1:108069892-108069914 ATTAATTTGCTTGGGGCTGATGG - Intergenic
912995092 1:114525080-114525102 ATTAATAGGCTTGTGTGTGAAGG + Intergenic
917230782 1:172835158-172835180 ATGAGTTGGCCTGTGATTGATGG + Intergenic
918193210 1:182196442-182196464 ATTAATTGGTTTTTGGTTGATGG - Intergenic
922276344 1:224082403-224082425 ATGAATTGAGGTGTGGTTGAGGG + Intergenic
923280820 1:232441488-232441510 ATGAACAGGCTTGTGGTTCTGGG + Intronic
923811080 1:237316889-237316911 GTGAATTGGTTTGTGGTTGTTGG - Intronic
1066355662 10:34681225-34681247 ATAAAGTGGCTTGTGTTTTATGG - Intronic
1070549517 10:77480166-77480188 ATTTATTGGCTTGTGGTTTAGGG - Intronic
1072466204 10:95664744-95664766 ATGAATTGGTGGGTGGTGGAAGG - Intronic
1072851068 10:98892660-98892682 ATGAATTAGCTTGTGGTTTTTGG - Intronic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1075581484 10:123621891-123621913 AGGAAGTGGATGGTGGTTGAGGG + Intergenic
1077400201 11:2351848-2351870 TTCTACTGGCTTGTGGTTGAGGG + Intergenic
1078549813 11:12272268-12272290 ATGACTGGGCTTGGGGATGAGGG - Intergenic
1078812816 11:14786520-14786542 AGGAAATGACTTGTGGTGGAAGG - Exonic
1079048965 11:17136205-17136227 ATGAGTTGGTTTGGGGTTTAAGG - Intronic
1082896975 11:58202191-58202213 ATGAATTGGGTTCTGTATGATGG + Intergenic
1083975970 11:66120575-66120597 ATGTATTAGATTGTGGTTAAGGG + Intronic
1089819740 11:121213582-121213604 ATGCAGTGGCTTGAGGGTGAGGG - Intergenic
1090056481 11:123429237-123429259 ATGCATTGGGCTGGGGTTGAAGG + Intergenic
1090503431 11:127284194-127284216 ATGAATGTGCTTGCAGTTGAGGG - Intergenic
1090912247 11:131131533-131131555 ATGAAGTGGCTTGTAGGAGAGGG + Intergenic
1090923814 11:131232085-131232107 ATGAACTTGCTTGTGGCTGGAGG + Intergenic
1092153008 12:6263971-6263993 AGGAATTGGCTCGTGGGTTATGG - Intergenic
1092286580 12:7132145-7132167 CTGAATTGGCTGGTGGTTGAAGG + Intronic
1093164748 12:15791519-15791541 ATGAATTGGCTGATGGCTGGGGG + Intronic
1093953846 12:25194614-25194636 ATGAATTGTTTTGTGATTCAAGG - Intronic
1096600634 12:52726162-52726184 ATGAGTTGGCTTAGGGTGGAAGG - Intergenic
1100339770 12:93667422-93667444 GTAAAGTGACTTGTGGTTGAGGG - Intergenic
1101518010 12:105454937-105454959 ATAAAATGGCTTGAGGTTGAAGG + Intergenic
1104831353 12:131754094-131754116 AAGAATTAGCTTGTGATTGGGGG + Intronic
1106314416 13:28580459-28580481 ATGAATTGGTTTGGGGTGGAAGG + Intergenic
1110398693 13:75064638-75064660 ATAAAAGGGCTTGAGGTTGAAGG - Intergenic
1110812508 13:79826490-79826512 ATTAATTGCCTTGTTGTTGCAGG - Intergenic
1113813993 13:113159185-113159207 GTGAAGTGGCTGGTGGTAGAAGG - Exonic
1114208703 14:20597804-20597826 AGGAATTGGCATTCGGTTGAAGG + Intronic
1120593934 14:86410857-86410879 ATGAAGTGTCTTGTGGATCATGG + Intergenic
1121412501 14:93757588-93757610 AGCAATTGGTCTGTGGTTGAAGG + Intronic
1122080864 14:99266781-99266803 TTGAATTGGCTTTTGGTTGATGG - Intronic
1124870662 15:33538731-33538753 AGGAATTGGCTTTTTATTGATGG + Intronic
1125626652 15:41114929-41114951 ATGAATTAAATAGTGGTTGATGG + Intronic
1125709839 15:41775528-41775550 ATGATTTGGTTTTAGGTTGAAGG + Intronic
1127694854 15:61435147-61435169 ATGACCTGGCTTCTGGTGGATGG + Intergenic
1129911373 15:79229898-79229920 ATAAAAGGGCTTGAGGTTGAAGG + Intergenic
1139242261 16:65404999-65405021 GTGAGTTGGGTTGTGGTTCAGGG + Intergenic
1140982001 16:80119385-80119407 GTGAATTGGCTTGTGGGAGTAGG + Intergenic
1143850902 17:9811164-9811186 AATAATTGGCTTCTTGTTGAAGG + Intronic
1157456154 18:47830165-47830187 ATGAAGTAGCTTGTGGTTCTTGG + Exonic
1159715970 18:71823706-71823728 ATAAAAGGGCTTGAGGTTGAAGG + Intergenic
1161538561 19:4835285-4835307 ATGGATGGGCTTGTGGGTGGAGG - Intergenic
1162177829 19:8844588-8844610 ATTAATTTGCTTTTGTTTGATGG - Intergenic
1163655868 19:18544368-18544390 ATTATTTTGCTTGTGGTTGGAGG + Intergenic
1164682550 19:30145318-30145340 ATTAATTGTTTTGTTGTTGATGG + Intergenic
1167075888 19:47248823-47248845 ATGTATTTGCTTGTCGTTAATGG + Intergenic
925229075 2:2215706-2215728 ATGAATTATCTTGTTGTTGGAGG - Intronic
925679404 2:6402458-6402480 AGGATTTGGCTTCAGGTTGAAGG + Intergenic
926089969 2:10043436-10043458 ACGAATTGGCTGGTGGTGGCCGG + Intronic
929256570 2:39817414-39817436 ATGTTTTGGCTTCTGGATGATGG + Intergenic
929395042 2:41513120-41513142 ATGATCTAGTTTGTGGTTGAAGG - Intergenic
929705318 2:44205763-44205785 ATAAATAGGCTTCTGGTAGATGG - Intronic
930843528 2:55875617-55875639 ATGAATTGGCTTGTGGTTGACGG + Intronic
931637609 2:64354923-64354945 AGAAGTTTGCTTGTGGTTGAAGG - Intergenic
931650778 2:64466893-64466915 AAGATTTGGCTTGTGGTTAGTGG - Intergenic
933382558 2:81568212-81568234 ATGAAATATCTTGTGTTTGAAGG + Intergenic
941068383 2:160928756-160928778 AAGAATAGGCTTTTGGTAGAGGG + Intergenic
942160768 2:173184479-173184501 ATGATGTGGCATGTGGTTAAGGG - Intronic
942846582 2:180433322-180433344 ATAAATTGGATTCTGGTTGCGGG + Intergenic
944578464 2:201112486-201112508 GAAAATTGGGTTGTGGTTGACGG + Intergenic
948568636 2:238902259-238902281 ATGAATTGGGGTGTGTGTGATGG + Intronic
1169731566 20:8791557-8791579 TAGAATTTGCTTATGGTTGATGG + Intronic
1170610363 20:17907784-17907806 ATGAAAGGGCTGGAGGTTGAAGG - Intergenic
1171227147 20:23451344-23451366 ATGATTTGACTGGTGGGTGAGGG - Intronic
1178184394 21:30203354-30203376 ATGTATTGTGTTGTGGTTTAAGG + Intergenic
1178210645 21:30527459-30527481 ATTAATTGGCATGAGTTTGAAGG + Intergenic
1181537059 22:23551853-23551875 ATGAATGGGAGGGTGGTTGAAGG - Intergenic
1181930467 22:26396587-26396609 AGAAATTGGCTTGGGGTAGAGGG + Intergenic
1184243619 22:43224452-43224474 CTGACTTGTCTTGTGTTTGATGG + Intronic
951048455 3:18067426-18067448 ATAAAAGGGCTTGGGGTTGAAGG + Intronic
951227092 3:20132821-20132843 ATTAATTGGATTATGGATGAAGG + Intronic
951554229 3:23904451-23904473 ATAAAAGGGCTTGAGGTTGAAGG - Intronic
952007744 3:28861465-28861487 TTTAATTGGCTTGTGGTTCAAGG + Intergenic
956953856 3:74314018-74314040 ATGAATGGGGTTGGAGTTGAAGG - Intronic
959672341 3:108993278-108993300 ATTAATTGGCTCGTGGTTGCTGG + Intronic
961211198 3:125127359-125127381 ATTTATTGGCTTCTGGATGAGGG + Intronic
966419701 3:179725254-179725276 ATGAATAGGCTTATGCTTTAAGG - Intronic
970186667 4:13462180-13462202 ATCAATTGGCTTGGGGTTCAGGG + Intronic
970509899 4:16771549-16771571 AAGAATTGGCTTGTAGGGGATGG - Intronic
972427628 4:38949061-38949083 ATGAATTGTTTTCTGGTTAATGG - Intergenic
975532397 4:75413948-75413970 ATTAATTTCCTTGTGGTTGGAGG - Intergenic
976521203 4:86029315-86029337 ATGAATTTCCCTGTGGATGAAGG - Intronic
977296432 4:95214689-95214711 AAGTATTGGCTTGTGCTTTATGG - Intronic
978264870 4:106811194-106811216 ATGAATTGCCCTCTTGTTGAAGG + Intergenic
978766357 4:112409081-112409103 AAGAATTTGCCTGTTGTTGAAGG - Intronic
978987004 4:115025061-115025083 TTTATTTGGCTTGTGGTTGTAGG - Intronic
984460648 4:180032471-180032493 ATGAATTGGTTTATGGTTCTAGG + Intergenic
985861291 5:2472626-2472648 ATGTATTGGCTTATTGTTGTTGG - Intergenic
986323781 5:6656076-6656098 AGGTTTTGGCTTGTGGTTAACGG + Exonic
986725955 5:10596720-10596742 ATGATGTGTCTTGGGGTTGATGG - Intronic
988218899 5:28316103-28316125 ATGAACTGGCTTTTGTCTGAAGG - Intergenic
993044870 5:82855509-82855531 ATTAATTAGCTTGTGGATGGTGG - Intergenic
993219937 5:85080699-85080721 AGGATTTGGCTTGTGGCTGCTGG + Intergenic
993571520 5:89545733-89545755 ATGAAGTGGCATTTAGTTGATGG - Intergenic
995099082 5:108276882-108276904 ATGCATTGGCTTATGTTTTATGG - Intronic
996393298 5:122986989-122987011 AGGAATTGGCTTCTGATGGAAGG + Intronic
996549604 5:124716357-124716379 TTTAAATGACTTGTGGTTGAAGG - Intronic
997029753 5:130112840-130112862 ATGAGTTGGGTTGTGGTCAAAGG - Intronic
997382383 5:133446886-133446908 ATGACTGGGCTGGTGGCTGAGGG + Intronic
998071848 5:139203918-139203940 ATTAATAGGTGTGTGGTTGAAGG - Intronic
1001796786 5:174508955-174508977 GTTAATTGGCTTGTGATTGCAGG - Intergenic
1002554173 5:180021388-180021410 ATGATGTACCTTGTGGTTGATGG - Intronic
1003651424 6:7964200-7964222 CTGAATTGCCTGGTGGTAGATGG - Intronic
1004020480 6:11771658-11771680 ATGAATTTGGTGGTGGTTGGTGG - Intronic
1004483941 6:16047905-16047927 ATGGAATGTCTTGTGGATGAGGG + Intergenic
1005304751 6:24503055-24503077 ATGCAATGACTTGTGGTTTAGGG + Intronic
1006235092 6:32623171-32623193 TAGAATAGGGTTGTGGTTGAAGG + Intergenic
1008904260 6:56658866-56658888 ATGCATAGGTCTGTGGTTGAAGG + Intronic
1011002979 6:82611889-82611911 ATGAACTGGCATGTGGAAGAAGG - Intergenic
1015025340 6:128525618-128525640 GTGAATTGGATTGAGGTGGAGGG + Intergenic
1015390506 6:132676571-132676593 AGCAACTGGCTTGTGGTAGAGGG - Intergenic
1017283738 6:152650968-152650990 ATGAAGTGACTTGTGTTTGCAGG + Intergenic
1018469416 6:164082631-164082653 ATGAACTGGGGTGTGGGTGAAGG + Intergenic
1019457191 7:1135290-1135312 TTGAGTTGGCGTGTAGTTGAAGG - Intronic
1020232557 7:6330994-6331016 ATGAATAAGCCTGTGGTTGATGG - Exonic
1020508935 7:9028142-9028164 GTGAATTTGTTTGTGGTTGGTGG + Intergenic
1022421733 7:30229880-30229902 ATAAAAGGGCTTGAGGTTGAAGG - Intergenic
1023988711 7:45114611-45114633 ATGAAGTGGCTTTTGGAAGATGG + Intergenic
1029263558 7:99321028-99321050 ATGAAATGACTGGTGGATGAGGG + Intergenic
1029554123 7:101256114-101256136 ATAGTTTGGATTGTGGTTGAAGG - Intergenic
1029896940 7:103992737-103992759 ATGAATAGGCTTGTGGGAAAGGG + Intergenic
1036777449 8:11623405-11623427 ATTACTTGGCTGGTGGTTTAGGG + Intergenic
1036837331 8:12084513-12084535 AAGAATTGGCTTGTGGGCGGTGG + Intergenic
1036859124 8:12330757-12330779 AAGAATTGGCTTGTGGGCGGTGG + Intergenic
1037245525 8:16830336-16830358 ATGAATTGCCTTGTTGTGTAAGG + Intergenic
1037686503 8:21144068-21144090 GTGAATTGGCTTGCAGATGAGGG - Intergenic
1037724025 8:21468281-21468303 AAGATTTGGCTGGTGGTAGAGGG - Intergenic
1039588206 8:38724846-38724868 CTGGATTGGTTTGTGGATGAGGG - Intergenic
1040738375 8:50539638-50539660 ATAAATGGGCTTGTGGGAGATGG - Intronic
1040985856 8:53293868-53293890 GTGAATTGGCTAGAGGTTGGTGG + Intergenic
1041821000 8:62032856-62032878 ATGAGATGGATTGTGGTTGAGGG + Intergenic
1043096591 8:75982955-75982977 ATGAAATGGATTGTCATTGAAGG + Intergenic
1047272892 8:123379408-123379430 ATAACTTAGCTTGTGGTTTATGG - Intronic
1047370243 8:124250217-124250239 ATGAATTAGATGGTGGATGAAGG - Intergenic
1048840567 8:138562442-138562464 ATTCATTGCCTTGTGGTTGTAGG + Intergenic
1050789462 9:9448028-9448050 ACGAACTGACTTGTGTTTGAAGG + Intronic
1051937113 9:22456717-22456739 ATGAATTGCCTAGTGGAAGAAGG - Intergenic
1053493243 9:38527238-38527260 ATGAATAAGCCTGCGGTTGATGG + Intergenic
1056578768 9:87875066-87875088 ATGAGTTGACTGGTGGCTGAAGG - Intergenic
1057897336 9:98919827-98919849 ATGCATTTGCCTGTGTTTGAAGG + Intergenic
1059862745 9:118483199-118483221 ATAAAAGGGCTTGAGGTTGAAGG + Intergenic
1061244723 9:129395578-129395600 ATGAATGGGAGGGTGGTTGAAGG + Intergenic
1187593770 X:20747691-20747713 ATGCATTTGATTGTGGTAGAAGG + Intergenic
1187921319 X:24205126-24205148 ATGAAAAGGCTTGTTGTTGCAGG + Intronic
1188520224 X:31030308-31030330 AAGAATTGGCTTTTGTCTGAGGG + Intergenic
1193529986 X:82644404-82644426 CTGAATTGACATGTGTTTGAAGG - Intergenic
1198194304 X:134344609-134344631 ATGAAAGGGCTTGACGTTGAAGG + Intergenic
1198646421 X:138811868-138811890 ATGGATTGGATTGGGGATGAGGG - Intronic
1199914401 X:152323194-152323216 AAGAATTCGGTAGTGGTTGATGG - Intronic