ID: 930851743

View in Genome Browser
Species Human (GRCh38)
Location 2:55968471-55968493
Sequence CCTCACATGGTGGAGGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930851743_930851756 10 Left 930851743 2:55968471-55968493 CCCCACCCCTCCACCATGTGAGG No data
Right 930851756 2:55968504-55968526 GAGGTGGTCGTTTGCAAGCCGGG No data
930851743_930851758 28 Left 930851743 2:55968471-55968493 CCCCACCCCTCCACCATGTGAGG No data
Right 930851758 2:55968522-55968544 CCGGGAAGAGAACCCTTACCAGG No data
930851743_930851754 -6 Left 930851743 2:55968471-55968493 CCCCACCCCTCCACCATGTGAGG No data
Right 930851754 2:55968488-55968510 GTGAGGACACAGCGAGGAGGTGG No data
930851743_930851755 9 Left 930851743 2:55968471-55968493 CCCCACCCCTCCACCATGTGAGG No data
Right 930851755 2:55968503-55968525 GGAGGTGGTCGTTTGCAAGCCGG No data
930851743_930851753 -9 Left 930851743 2:55968471-55968493 CCCCACCCCTCCACCATGTGAGG No data
Right 930851753 2:55968485-55968507 CATGTGAGGACACAGCGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930851743 Original CRISPR CCTCACATGGTGGAGGGGTG GGG (reversed) Intergenic
No off target data available for this crispr