ID: 930855287

View in Genome Browser
Species Human (GRCh38)
Location 2:56009378-56009400
Sequence CTGGGGTATTTGCAGGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930855277_930855287 27 Left 930855277 2:56009328-56009350 CCCTGGTAACAGTTAACTAGCAC No data
Right 930855287 2:56009378-56009400 CTGGGGTATTTGCAGGTGGTGGG No data
930855278_930855287 26 Left 930855278 2:56009329-56009351 CCTGGTAACAGTTAACTAGCACG No data
Right 930855287 2:56009378-56009400 CTGGGGTATTTGCAGGTGGTGGG No data
930855282_930855287 -10 Left 930855282 2:56009365-56009387 CCAACTGCTTTTCCTGGGGTATT No data
Right 930855287 2:56009378-56009400 CTGGGGTATTTGCAGGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930855287 Original CRISPR CTGGGGTATTTGCAGGTGGT GGG Intergenic
No off target data available for this crispr