ID: 930858753

View in Genome Browser
Species Human (GRCh38)
Location 2:56047228-56047250
Sequence GTTCAGCAGCACCTTGCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 11, 3: 50, 4: 209}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930858750_930858753 -2 Left 930858750 2:56047207-56047229 CCTAGTTGTACTTACCTTATAGT 0: 1
1: 1
2: 0
3: 6
4: 118
Right 930858753 2:56047228-56047250 GTTCAGCAGCACCTTGCTGGTGG 0: 1
1: 0
2: 11
3: 50
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930858753 Original CRISPR GTTCAGCAGCACCTTGCTGG TGG Intergenic
901768915 1:11520777-11520799 GTCCAGCAGCACCTGGATGTTGG - Exonic
901791556 1:11655900-11655922 GTTCAGCAGCAGCTGGCGGGCGG - Exonic
901793789 1:11668744-11668766 GTTCAGCAGCAGCTGGCGGGCGG - Exonic
902806795 1:18865935-18865957 GTTCAGAAGCACCTCGGAGGAGG + Intronic
903214986 1:21838922-21838944 GTGCAGCAGCTCGTTCCTGGCGG + Exonic
903885485 1:26538672-26538694 GTTCAACATCACATAGCTGGTGG + Intronic
904275289 1:29379820-29379842 ATTAAGCAGCACCATGCTGTAGG - Intergenic
904301031 1:29555204-29555226 GTTCACCAGAGCCCTGCTGGGGG + Intergenic
905510758 1:38517833-38517855 GTTTAGCAGAACCTTCCTGCTGG - Intergenic
909051498 1:70773752-70773774 GGTCAGCTGCAGCTTGTTGGAGG + Intergenic
909460608 1:75908955-75908977 GTACAGCAGCACCATGCTAGAGG - Intronic
912731344 1:112109053-112109075 GTTGAGCAGCACCATGCAGTAGG - Intergenic
915880371 1:159664796-159664818 GTTCAGCAGCACCATGCAGTAGG - Intergenic
917149383 1:171928589-171928611 GGTCAACTGCAGCTTGCTGGAGG + Intronic
918621033 1:186606102-186606124 GTTCAGCAGCACCGGGCTCTAGG - Intergenic
921426126 1:215002978-215003000 ATTCATCCCCACCTTGCTGGGGG + Intergenic
921735655 1:218624759-218624781 GTGAAGCACGACCTTGCTGGAGG - Intergenic
921942195 1:220853730-220853752 GTTCAGCAGCACCATGCTGTAGG - Intergenic
923271575 1:232359568-232359590 GTTCAGCAGCGACTTGCTGAGGG + Intergenic
923937656 1:238781381-238781403 GTTCAGCACCATCATGCTGTAGG - Intergenic
1065496570 10:26335410-26335432 GTTTGGCAGCACCATGCTGTAGG - Intergenic
1065841958 10:29709677-29709699 TTTCGGCAGCACCCTGCAGGTGG + Intronic
1067681221 10:48442552-48442574 GTTCAGCTGCACACTGGTGGTGG - Intergenic
1069804693 10:71112980-71113002 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1070040357 10:72772204-72772226 GTTCAGCAGCACCATGCTGTAGG + Intronic
1070580299 10:77713933-77713955 TTCCAGAAGCACCCTGCTGGAGG - Intergenic
1070971215 10:80569033-80569055 TTTCAGCAGCACCCTGCTTCTGG + Intronic
1072772096 10:98150713-98150735 GTTCAGCAGCACCACGCTGTAGG - Intronic
1072854742 10:98935554-98935576 GGTCTGCTGCAGCTTGCTGGGGG + Intronic
1072953465 10:99869239-99869261 GTTCTGCTGCAGTTTGCTGGAGG + Intergenic
1075206860 10:120456449-120456471 GTTCAGCAGCCCCAAGCTGCTGG + Intergenic
1076926329 10:133490001-133490023 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1078361318 11:10670072-10670094 GATCAGCAGCACCTTGTTTTTGG + Intronic
1080192481 11:29568804-29568826 GTTCAGCAGCACTATGCTGTGGG + Intergenic
1080716995 11:34812505-34812527 GTTCAGCAGCACCATACTGTAGG + Intergenic
1080873594 11:36257959-36257981 GTCCAGCAGCCCCTTGCTTTTGG - Intergenic
1081040292 11:38201496-38201518 ATTCAGCAGCATCATGCTGTAGG + Intergenic
1082162827 11:48902167-48902189 AGCCAGCAGCACCATGCTGGTGG + Intergenic
1082935428 11:58652094-58652116 GCTCAGCAGCACCATGCTATAGG - Intronic
1084499375 11:69525715-69525737 GTGCGGCATCACCTTGCTGGGGG + Intergenic
1084665498 11:70574077-70574099 CTCCATCAGCACCATGCTGGGGG - Intronic
1084666718 11:70580368-70580390 GTTCAGAGACACCCTGCTGGTGG - Intronic
1085335072 11:75687394-75687416 GGTCTGCAGCAGTTTGCTGGGGG + Intergenic
1086035960 11:82414702-82414724 TTTTAGCAGCACCATGCTGTAGG + Intergenic
1086303825 11:85459103-85459125 GTGCAAGAGCAGCTTGCTGGAGG + Intronic
1091801467 12:3327251-3327273 GTCCAGAAGCATCTTGCTGGTGG - Intergenic
1092481927 12:8867318-8867340 GTTCAGTAGTACCTTGTTGATGG + Intronic
1092704710 12:11269658-11269680 AATCAGTAGCATCTTGCTGGAGG + Exonic
1092708616 12:11310387-11310409 AATCAGCAGCATCTCGCTGGAGG + Exonic
1092941391 12:13410465-13410487 GTTTAGCAGCACCATGCTGTAGG + Intergenic
1093142663 12:15527549-15527571 GTTCAGCAGCACCATACTGTAGG + Intronic
1094471694 12:30807462-30807484 CTTCAGCAGCACCATGCTGTAGG + Intergenic
1095777632 12:46026740-46026762 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1097786700 12:63768041-63768063 GTGCAGCAGCACCCAGCTGAGGG + Intergenic
1099434551 12:82627897-82627919 GTTCAGCAGCACCGCACTGTAGG + Intergenic
1101364359 12:104058000-104058022 GTTCAGCAGCACCACACTGTAGG - Intronic
1101792611 12:107941592-107941614 GTTCAGCTGCACCATGCAGAAGG + Intergenic
1102619455 12:114182507-114182529 GGTCAGCACCAACTTGCTGTAGG + Intergenic
1104643789 12:130483541-130483563 GTTTAGCACCATCTTGGTGGGGG - Intronic
1104725680 12:131074359-131074381 GCTCAGCAGCCCCTGGCTTGAGG + Intronic
1105981963 13:25526677-25526699 GCTTAGCAGCACCATGCTGTAGG - Intronic
1107963495 13:45579191-45579213 GATCAGTAGTACCTTTCTGGCGG + Intronic
1108769413 13:53680266-53680288 GTTCAGCAGTACCATGCTGTAGG - Intergenic
1109318684 13:60782583-60782605 GGTCAGCTGCAGCTTGCTGAAGG + Intergenic
1109362711 13:61316845-61316867 GTTCAGCAGCACCATGTGGTAGG - Intergenic
1116745597 14:48814591-48814613 GTTCAGCAGCACTATGCTGCAGG + Intergenic
1118547346 14:66906183-66906205 GTTCAGCAGTACCACGCTGTAGG - Intronic
1119795993 14:77398071-77398093 GCTCAGAAGTAGCTTGCTGGAGG + Intronic
1121045790 14:90786431-90786453 TTCCAGAAGGACCTTGCTGGGGG - Intronic
1121742489 14:96264045-96264067 GTTCATCAGCATCTTCCTGGTGG + Exonic
1123219478 14:106842797-106842819 GTGCGGCAGCCCCCTGCTGGTGG + Intergenic
1124589405 15:31040166-31040188 GGTCAGCAGCATCTGGCTGCAGG + Exonic
1124718815 15:32093924-32093946 GTTCAGAATCACTCTGCTGGGGG + Intronic
1125481256 15:40082440-40082462 GTTCCGAAGCACCTTGGTGAAGG - Intergenic
1127188079 15:56500851-56500873 GTTCAGCAGCATCGTGCTGTAGG + Intergenic
1127678538 15:61269809-61269831 TTTCAACAGCCCCTTGCTGTGGG - Intergenic
1129960004 15:79675590-79675612 GTTCAGGAACACAGTGCTGGTGG - Intergenic
1130108213 15:80944877-80944899 GAGCAGCAGCACCTCTCTGGGGG + Intronic
1130172966 15:81535717-81535739 GTTCAGCAGCTCCAGGCTGTAGG + Intergenic
1130484544 15:84391402-84391424 GTTCAGCAGCCCCTCTCTGCAGG + Intergenic
1130834070 15:87632192-87632214 GTCCACCAGAAGCTTGCTGGTGG - Intergenic
1132244662 15:100285074-100285096 TTTTGCCAGCACCTTGCTGGAGG + Intronic
1132803434 16:1765077-1765099 GATGATCACCACCTTGCTGGTGG - Exonic
1135977813 16:27122404-27122426 TTGCACCAGCAGCTTGCTGGGGG - Intergenic
1136748094 16:32609836-32609858 GACCATCAGCACCTTGCTGGTGG - Intergenic
1138476060 16:57271226-57271248 GGGCTGCAGGACCTTGCTGGGGG - Intronic
1141242721 16:82277990-82278012 ACTCAGCAGCACCTTCATGGAGG - Intergenic
1142438476 16:90077981-90078003 GTACAGAAGAACCTTGCTGCTGG - Intronic
1203050231 16_KI270728v1_random:869043-869065 GACCATCAGCACCTTGCTGGTGG - Intergenic
1143088461 17:4434210-4434232 GATCTGCAGCCCCTGGCTGGTGG - Intronic
1146367532 17:32240723-32240745 CTACAGCTGCACCTGGCTGGTGG - Intronic
1147400665 17:40178333-40178355 GTTCTGGAGCGGCTTGCTGGAGG + Intronic
1148806810 17:50268016-50268038 GTTCTGCTGCACCCTGCTTGTGG - Intergenic
1149636273 17:58172488-58172510 GTCCAGCAGCACCATGCTGTAGG + Intergenic
1149949355 17:60968732-60968754 GTTCAGCAGCACCATGTAGTAGG - Intronic
1151756690 17:76079306-76079328 GTTCAGCATTACCTTGCTGTTGG + Exonic
1151897877 17:76992511-76992533 GCTCAGCAGAACCTTGCTTTAGG - Intergenic
1152342593 17:79733556-79733578 GGGCAGCTTCACCTTGCTGGTGG - Exonic
1153582709 18:6591100-6591122 GCACAGCAGGACCTTGCTGGAGG - Intergenic
1153722606 18:7922248-7922270 GTTAAGCAGCACCTCACTGTAGG - Intronic
1155011917 18:21787319-21787341 GTTCAGCAGCACTATACTGCAGG - Intronic
1155113702 18:22742621-22742643 GTTCAGCAGCACCACACTGTAGG + Intergenic
1155978007 18:32152761-32152783 GTTCAGCAGCACCACACTGTAGG - Intronic
1156595480 18:38543275-38543297 GGTCAGAAGGACCTGGCTGGTGG + Intergenic
1156609996 18:38714628-38714650 GTTAAGCAGCAACTTCCTAGAGG + Intergenic
1157605682 18:48924525-48924547 GTCTGGCAGCACATTGCTGGCGG - Intronic
1157917472 18:51680319-51680341 GTTCAGCACCACCAGGCTGTAGG + Intergenic
1160355020 18:78220255-78220277 GAACAGAAGCACCTTGCAGGGGG + Intergenic
1162265753 19:9572560-9572582 GTTCAGGAGCACCATACTGTAGG + Intronic
1162384472 19:10353030-10353052 GTCCAGCAGCACGTTGCGCGCGG + Exonic
1162997935 19:14348340-14348362 GTTCAGCAGCTCCATGCCTGGGG - Intergenic
1163065129 19:14786732-14786754 GTTCAGCAGCTCCATGCCTGGGG + Intergenic
1163368642 19:16889792-16889814 GTTCATCAGCAGCATGGTGGAGG - Exonic
1165566185 19:36730293-36730315 GTTCAGCAGCAGCATGCTGTAGG + Intronic
1166777609 19:45322511-45322533 GCTCAACAGCCCCTTGCAGGGGG + Intronic
925418675 2:3692707-3692729 GTTCAGCAACACCATGTTGTAGG - Intronic
926610848 2:14945083-14945105 GTTCAGCAGCACCAAGCTGCCGG + Intergenic
926875397 2:17471139-17471161 GTTCAGCAGCACAATGCTGTAGG - Intergenic
927523830 2:23719904-23719926 GTTAAGCAGCGCCATGCTGTAGG + Intergenic
930858753 2:56047228-56047250 GTTCAGCAGCACCTTGCTGGTGG + Intergenic
932609056 2:73185187-73185209 GTTCAGCAGCACCATCCTCTTGG - Intergenic
933064278 2:77773897-77773919 TTTCAGCAGCACCTCGCTCCTGG + Intergenic
934052954 2:88225509-88225531 GTGCAGGAGCAGCTTCCTGGAGG + Intergenic
934782199 2:96977917-96977939 GTTCAGCAGTTCATCGCTGGAGG + Intronic
936077562 2:109411432-109411454 GCTCAGCAGCACGCTACTGGGGG - Intronic
936707456 2:115091182-115091204 GTACAGTGGAACCTTGCTGGAGG - Intronic
939080410 2:137654297-137654319 GTTCAGCAGTACCACGCTGTAGG - Intronic
941477870 2:165970774-165970796 GCTCACCAGCACCATGCTGTAGG + Intergenic
941802214 2:169672540-169672562 TTGCACCAGCAGCTTGCTGGGGG - Intronic
942027276 2:171922658-171922680 GCCCAGCAGCTCCTTGTTGGCGG + Intronic
943102479 2:183505172-183505194 GTTCAGCAGCATCATGCTGTTGG - Intergenic
943659505 2:190543260-190543282 GTTCATCAGCACTGTGCTGTCGG - Intergenic
947305386 2:228740634-228740656 GTACAGCAGCACCATGCTCTAGG - Intergenic
948619250 2:239223702-239223724 TTTGAGCAGGACCTTGCTGCTGG + Intronic
948739962 2:240039849-240039871 GTTCAGCAGCACCATGCTGTAGG - Intergenic
948870313 2:240794573-240794595 CTTCAGCAGCTCCCAGCTGGCGG + Intronic
1170477366 20:16729542-16729564 GTTCATCAGCACAGTGTTGGAGG + Intergenic
1170524835 20:17227119-17227141 GTTCTCCAGCATCTGGCTGGAGG - Exonic
1170863492 20:20130774-20130796 GTTCAGCAGCACCACACTGTAGG - Intronic
1171375580 20:24692128-24692150 GTTCAGGGGCACATTGCGGGTGG - Intergenic
1171427090 20:25056130-25056152 GTTCAGAAGGTCCTTGCTGTTGG + Intronic
1171508347 20:25658171-25658193 GTTCACCAGCACCATGCTGTAGG - Intergenic
1171722516 20:28578546-28578568 GTTCAGGAGCAGCTTGGAGGTGG + Intergenic
1171755568 20:29104899-29104921 GTTCAGGAGCAGCTTGGAGGTGG - Intergenic
1171787113 20:29477983-29478005 GTTCAGGAGCAGCTTGGAGGTGG + Intergenic
1171860851 20:30401404-30401426 GTTCAGGAGCAGCTTGGAGGTGG - Intergenic
1173444325 20:43104238-43104260 GTTCATCAGAATCTTGCTGAAGG - Intronic
1175395752 20:58660140-58660162 GTTCTGCATCTCCTAGCTGGGGG + Intronic
1175489607 20:59371007-59371029 GTGCAGAAGCATGTTGCTGGAGG + Intergenic
1175908591 20:62393915-62393937 GTCCAGGAGCACCTGGCTGTGGG + Intronic
1176145785 20:63564856-63564878 TTTCTGCAGCACCTTGGTGATGG + Exonic
1180092567 21:45540502-45540524 CAGCAGCAGCCCCTTGCTGGCGG - Intronic
1180158418 21:45988593-45988615 GTTCAGAAGGACCTTTCTGGAGG + Intronic
1180296067 22:10937235-10937257 GTTCAGGAGCAGCTTGGAGGTGG + Intergenic
1180412607 22:12628779-12628801 GTTCAGGAGCAGCTTGGAGGTGG - Intergenic
1180958415 22:19751376-19751398 GTTCAGCAGAGCCTTGGAGGAGG + Intergenic
1181473240 22:23153483-23153505 GCTCAGCAGCAACCTGCGGGAGG - Intronic
1184419987 22:44374150-44374172 CTTTAGGAGCACCTAGCTGGTGG + Intergenic
1185182769 22:49372705-49372727 AGTCAGCAGGACCTGGCTGGGGG + Intergenic
949946663 3:9194990-9195012 GTTTAGCAGCCACTTTCTGGTGG + Intronic
950724264 3:14906352-14906374 GTGCACCAATACCTTGCTGGGGG - Intronic
953743996 3:45559453-45559475 GCTGAGCAGCACCTTGATGATGG + Intronic
955395226 3:58552470-58552492 GTTCAGCAGCACCATGCTGTAGG - Intergenic
961326587 3:126112719-126112741 GGACAGCAGCGCCTGGCTGGAGG - Intronic
961455876 3:127023669-127023691 GCTCAGCAGCATCTGGCTGCAGG - Intronic
962200731 3:133399382-133399404 GTTCATCAGCTGCTTGCTGTTGG - Intergenic
962497928 3:135961580-135961602 GTTCAGCAGCAACATGATGTAGG - Intergenic
962763309 3:138538286-138538308 GTTCAGCAGCACCACACTGTAGG + Intronic
964803543 3:160581213-160581235 GCTCAGCAGCAACATGCTGTAGG + Intergenic
965493411 3:169367673-169367695 CTTCAGCAGCACTCTACTGGTGG + Intronic
965884629 3:173429869-173429891 GTTCAGCAGCAACATGCTTTAGG - Intronic
967688822 3:192449461-192449483 GTTCCACAGCACCCTGCTGTCGG + Intronic
968205341 3:196794734-196794756 GTTCAGCAACACCATGTTGTAGG + Intronic
968658818 4:1790384-1790406 GGGCAGCAACTCCTTGCTGGTGG + Intergenic
968953299 4:3705802-3705824 GGTCAGCAGCACATTTCTGGAGG - Intergenic
969473823 4:7409399-7409421 GTTCAGCAGCACCATGCTGTTGG - Intronic
969512694 4:7628569-7628591 GTTCAGCAGCACTGAGCTCGTGG + Intronic
972801327 4:42478665-42478687 GTCCTCTAGCACCTTGCTGGGGG + Intronic
973321910 4:48818295-48818317 GGTCTGCTGCAGCTTGCTGGAGG - Intronic
976614951 4:87066779-87066801 GTTTATCAGCACTTTCCTGGTGG + Intronic
976833890 4:89348173-89348195 GTTCAGCAGTATCATGCTGTAGG - Intergenic
978208253 4:106105149-106105171 GTTCAACTGCAGCTTGTTGGAGG - Intronic
978888217 4:113791234-113791256 GTTCAGCAGCCCTATGCTGTAGG + Intergenic
980868045 4:138576758-138576780 ATTCAGCAGCACCATGCTGTAGG + Intergenic
981159554 4:141481723-141481745 GTTCAGCAGCAGTATGCTGTAGG - Intergenic
981900692 4:149858378-149858400 ATTCAGCAGCACCATGCTGTAGG + Intergenic
982387943 4:154832969-154832991 ATTCAGCCTCACCATGCTGGGGG - Intergenic
983655622 4:170080587-170080609 GTTCAGCAGCACCACACTGCAGG + Intronic
985439716 4:189971881-189971903 GTTCAGGAGCAGCTTGGAGGTGG - Intergenic
985655555 5:1129785-1129807 GTTCAGAAGCACCTTGGAGCCGG + Intergenic
986719151 5:10547713-10547735 GGTCAGCAGCAGCATGGTGGGGG - Intergenic
986721627 5:10564460-10564482 GGCCAGCAGCACCATGCCGGCGG - Exonic
987620489 5:20333796-20333818 GCCCAGCAGCATCTTACTGGAGG + Intronic
993145152 5:84085443-84085465 GGTCAGCTGCAGTTTGCTGGAGG + Intronic
995278792 5:110308861-110308883 GTTTAGCAGCACCATACTGTAGG + Intronic
995827534 5:116317395-116317417 GTTCAACAGCAACATGCTGTAGG - Intronic
996113454 5:119592340-119592362 GTTCTGCAGCACCATGCTGTAGG + Intronic
996242615 5:121221807-121221829 GGTCTGCTGCACTTTGCTGGAGG - Intergenic
996511830 5:124325076-124325098 CTTCAGCAGATCCTTTCTGGGGG + Intergenic
998148351 5:139743232-139743254 GCTCACCAGCACCTTGCTGGAGG + Intergenic
998580700 5:143372416-143372438 GTTCAGCATCTCCATGCTGTAGG - Intronic
999412402 5:151363277-151363299 GTTCAGCAGCACCACACTGTAGG - Intergenic
1000806111 5:165794824-165794846 GTTCATCAGAACCATGCTGTGGG - Intergenic
1001989323 5:176103187-176103209 GACCATCAGCACCTTGGTGGTGG - Intronic
1002227547 5:177734951-177734973 GACCATCAGCACCTTGGTGGTGG + Intronic
1002892604 6:1348608-1348630 TTTCTGCTGCACCTGGCTGGTGG - Intergenic
1003079623 6:3010744-3010766 GTTCAGCAGCACCACACTGTAGG + Intronic
1003573096 6:7268771-7268793 GTTCAGCCAGTCCTTGCTGGCGG + Intronic
1005213172 6:23493192-23493214 CTTCAGCAGAGCCTTGGTGGTGG - Intergenic
1005639930 6:27786274-27786296 GTTCATCAACACTTTGCTGGGGG + Intergenic
1009457285 6:63872126-63872148 GTTCAGCAGCATCTTTGTGGTGG + Intronic
1010527563 6:76922536-76922558 GTTCAGCAGCTACTTGCTATAGG + Intergenic
1015143119 6:129958139-129958161 GGCCCGCAGCACCTTGCTGAAGG + Intergenic
1015216856 6:130760076-130760098 ATTCAGCAGCACCATGCTATAGG + Intergenic
1016263771 6:142207445-142207467 GTTCAGCAGTACCATGCTGTAGG + Intronic
1019117696 6:169778606-169778628 ATTGAGCAGCACCTTTCTGGAGG - Intronic
1019217322 6:170452297-170452319 CTTCAGCAGCACCCTCCTGGTGG - Intergenic
1020116668 7:5480066-5480088 TTTCAGCAGCTCCTTGCTCTGGG - Intronic
1021771830 7:24010811-24010833 GTTCAGCAGCACCACACTGTAGG - Intergenic
1023721383 7:43098990-43099012 GAACAGCAGCACCTTTCTGCTGG + Intergenic
1023846308 7:44122705-44122727 GTTCAGAGGCCCCTTGCTGTGGG - Intronic
1025040637 7:55641525-55641547 GTTCAGTAACACCATGCTGTAGG - Intergenic
1028560362 7:92168460-92168482 ATTCAGCAGCACCATGCTGTAGG + Intronic
1030200888 7:106902311-106902333 GGTCAGCTGCAGCTTGCTGGAGG + Intronic
1030855316 7:114548731-114548753 ATTCAGCAGTAACTTCCTGGAGG - Intronic
1035986516 8:4438482-4438504 GTTCCACAGCACCTGGCTGTAGG + Intronic
1036475565 8:9089844-9089866 GTTCAGGTGCATTTTGCTGGTGG + Intronic
1036729586 8:11250462-11250484 GCTCAGCTGCACATAGCTGGGGG + Intergenic
1037993361 8:23336301-23336323 GGTCTGCAGCACATTCCTGGGGG - Intronic
1038751770 8:30302726-30302748 GTTCAGCAGCAGCATGGAGGAGG - Intergenic
1039869479 8:41533441-41533463 GCACAGCTGCAGCTTGCTGGTGG + Intronic
1040774350 8:51021295-51021317 GTTCAGCATCACCATGCTATAGG + Intergenic
1041996126 8:64060515-64060537 GTTCAGGAGCACCGTTCTGTAGG + Intergenic
1043033125 8:75164249-75164271 GTTCGGCAGCACCATGCTGAAGG - Intergenic
1043280137 8:78453768-78453790 GTTTAGGGGCACCTTGCTGCAGG + Intergenic
1043475962 8:80606375-80606397 GTTGAGAACCACCTTGCTGGAGG + Intergenic
1045932848 8:107647284-107647306 GATCAGCACCAGCTTGCAGGTGG - Intergenic
1047697886 8:127420948-127420970 GTTCATCAGCACAAAGCTGGAGG + Intergenic
1048197426 8:132343624-132343646 CACCAGCAGCACCTTGGTGGTGG - Intronic
1049647602 8:143742647-143742669 GCTCAGCCACACCTTCCTGGTGG - Intergenic
1049953590 9:670597-670619 GTTCGGCAGCACTATGCTGTAGG - Intronic
1049964711 9:767612-767634 GGTCTGCTGCACCTTGCTGGAGG - Intergenic
1050388627 9:5113969-5113991 CATCAGCATCACCTGGCTGGAGG + Intronic
1050841821 9:10158979-10159001 GTTCAGCAGCACCATGTTGTAGG + Intronic
1051710723 9:19927957-19927979 GGTCTGCTGCACCTGGCTGGGGG + Intergenic
1052689544 9:31800037-31800059 GTTCAGCAGCACCATGCTATAGG + Intergenic
1052734671 9:32328812-32328834 GTTCAGCAGCACCGTGCTGTAGG + Intergenic
1054737519 9:68770390-68770412 GTCCTCCTGCACCTTGCTGGGGG + Intronic
1055477919 9:76681698-76681720 GTTGAAGAGCACCTTTCTGGTGG - Intronic
1057296303 9:93845023-93845045 GTTCACCAGCACCATGCTGTAGG - Intergenic
1057826576 9:98376763-98376785 GTACAGCAGAGCCTTTCTGGGGG + Intronic
1059365226 9:113781582-113781604 GTATAGCAGGACCTTCCTGGGGG - Intergenic
1060166955 9:121425315-121425337 GTTCAGCAGCACCACGCTGTGGG + Intergenic
1185735121 X:2490258-2490280 CTTCAGCAGCACCTTGAAGGTGG + Exonic
1187941406 X:24386331-24386353 GTTCAGCAGCACCGTGTTGTAGG - Intergenic
1188479026 X:30618444-30618466 GCTCAGCAGCACCATGCTATAGG + Intergenic
1188617979 X:32182024-32182046 TTTCAGCTGCACCTTGCCTGTGG - Intronic
1189231588 X:39456161-39456183 GTTCACCAGGACACTGCTGGGGG + Intergenic
1189544986 X:42033508-42033530 ATTTAGCAGCAGCTAGCTGGGGG + Intergenic
1192034171 X:67545565-67545587 CTGCGGCAGCCCCTTGCTGGCGG - Exonic
1192760769 X:74094172-74094194 TTTCAGCAGCACCATGCTGGAGG + Intergenic
1193178247 X:78420874-78420896 GTTCAGCACCACCATGTTGTAGG + Intergenic
1194530037 X:95035917-95035939 GTTCATCAGCACCATGCTGTAGG - Intergenic
1194591082 X:95800456-95800478 TTGCACCAGCAGCTTGCTGGGGG + Intergenic
1195073568 X:101304636-101304658 GTTCAGCAGCATCATGCTGTAGG - Intergenic
1195473484 X:105259676-105259698 GGTCAACTGCAGCTTGCTGGTGG + Intronic
1196980928 X:121212942-121212964 GGTCAGCAGCACCATGCTACAGG - Intergenic
1197260612 X:124313209-124313231 GTTCAGCAGCACCACACTGCAGG + Intronic
1198929162 X:141834996-141835018 CATCAGCAGCACCGTGTTGGGGG + Intergenic
1199194821 X:145016010-145016032 ATTCAGCAGCACCATGCTATAGG + Intergenic
1199245045 X:145593953-145593975 GTTCAGCAGCAGCATGCTATAGG + Intergenic