ID: 930859910

View in Genome Browser
Species Human (GRCh38)
Location 2:56060894-56060916
Sequence AAGGACTCCTTTGGGAAAAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930859910_930859917 20 Left 930859910 2:56060894-56060916 CCGGTTTTCCCAAAGGAGTCCTT No data
Right 930859917 2:56060937-56060959 CAGATTTGTCAAAGATCAGATGG 0: 312
1: 6328
2: 3935
3: 2626
4: 3018

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930859910 Original CRISPR AAGGACTCCTTTGGGAAAAC CGG (reversed) Intergenic
No off target data available for this crispr