ID: 930859917

View in Genome Browser
Species Human (GRCh38)
Location 2:56060937-56060959
Sequence CAGATTTGTCAAAGATCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 16219
Summary {0: 312, 1: 6328, 2: 3935, 3: 2626, 4: 3018}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930859911_930859917 12 Left 930859911 2:56060902-56060924 CCCAAAGGAGTCCTTTCCCCATT No data
Right 930859917 2:56060937-56060959 CAGATTTGTCAAAGATCAGATGG 0: 312
1: 6328
2: 3935
3: 2626
4: 3018
930859912_930859917 11 Left 930859912 2:56060903-56060925 CCAAAGGAGTCCTTTCCCCATTG No data
Right 930859917 2:56060937-56060959 CAGATTTGTCAAAGATCAGATGG 0: 312
1: 6328
2: 3935
3: 2626
4: 3018
930859910_930859917 20 Left 930859910 2:56060894-56060916 CCGGTTTTCCCAAAGGAGTCCTT No data
Right 930859917 2:56060937-56060959 CAGATTTGTCAAAGATCAGATGG 0: 312
1: 6328
2: 3935
3: 2626
4: 3018
930859914_930859917 -4 Left 930859914 2:56060918-56060940 CCCCATTGCTTGTTTTTGTCAGA 0: 217
1: 5057
2: 12734
3: 5215
4: 2251
Right 930859917 2:56060937-56060959 CAGATTTGTCAAAGATCAGATGG 0: 312
1: 6328
2: 3935
3: 2626
4: 3018
930859915_930859917 -5 Left 930859915 2:56060919-56060941 CCCATTGCTTGTTTTTGTCAGAT 0: 229
1: 5174
2: 12922
3: 5127
4: 2267
Right 930859917 2:56060937-56060959 CAGATTTGTCAAAGATCAGATGG 0: 312
1: 6328
2: 3935
3: 2626
4: 3018
930859913_930859917 1 Left 930859913 2:56060913-56060935 CCTTTCCCCATTGCTTGTTTTTG 0: 4153
1: 12264
2: 5516
3: 2668
4: 3653
Right 930859917 2:56060937-56060959 CAGATTTGTCAAAGATCAGATGG 0: 312
1: 6328
2: 3935
3: 2626
4: 3018
930859916_930859917 -6 Left 930859916 2:56060920-56060942 CCATTGCTTGTTTTTGTCAGATT 0: 238
1: 5310
2: 12915
3: 5008
4: 2258
Right 930859917 2:56060937-56060959 CAGATTTGTCAAAGATCAGATGG 0: 312
1: 6328
2: 3935
3: 2626
4: 3018

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930859917 Original CRISPR CAGATTTGTCAAAGATCAGA TGG Intergenic
Too many off-targets to display for this crispr