ID: 930863709

View in Genome Browser
Species Human (GRCh38)
Location 2:56102497-56102519
Sequence GGGTGGGCCAATGCAAATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930863709_930863715 3 Left 930863709 2:56102497-56102519 CCTCAATTTGCATTGGCCCACCC No data
Right 930863715 2:56102523-56102545 AATTTGCTTGTAATTGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930863709 Original CRISPR GGGTGGGCCAATGCAAATTG AGG (reversed) Intergenic
No off target data available for this crispr