ID: 930865782

View in Genome Browser
Species Human (GRCh38)
Location 2:56120785-56120807
Sequence CAGATGTTCTGGGGGAGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930865773_930865782 18 Left 930865773 2:56120744-56120766 CCAACTAGATTCTGTCAACAGCA No data
Right 930865782 2:56120785-56120807 CAGATGTTCTGGGGGAGAAAGGG No data
930865772_930865782 19 Left 930865772 2:56120743-56120765 CCCAACTAGATTCTGTCAACAGC No data
Right 930865782 2:56120785-56120807 CAGATGTTCTGGGGGAGAAAGGG No data
930865775_930865782 -8 Left 930865775 2:56120770-56120792 CCAACATGAGGTCCACAGATGTT No data
Right 930865782 2:56120785-56120807 CAGATGTTCTGGGGGAGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930865782 Original CRISPR CAGATGTTCTGGGGGAGAAA GGG Intergenic
No off target data available for this crispr