ID: 930866064 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:56123219-56123241 |
| Sequence | CTTGGCCAAGAGCTGGGGCA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 930866064_930866070 | 7 | Left | 930866064 | 2:56123219-56123241 | CCTTGCCCCAGCTCTTGGCCAAG | No data | ||
| Right | 930866070 | 2:56123249-56123271 | TGAATAAACTTACAGATCACTGG | No data | ||||
| 930866064_930866072 | 15 | Left | 930866064 | 2:56123219-56123241 | CCTTGCCCCAGCTCTTGGCCAAG | No data | ||
| Right | 930866072 | 2:56123257-56123279 | CTTACAGATCACTGGACCTTGGG | No data | ||||
| 930866064_930866071 | 14 | Left | 930866064 | 2:56123219-56123241 | CCTTGCCCCAGCTCTTGGCCAAG | No data | ||
| Right | 930866071 | 2:56123256-56123278 | ACTTACAGATCACTGGACCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 930866064 | Original CRISPR | CTTGGCCAAGAGCTGGGGCA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||