ID: 930866064

View in Genome Browser
Species Human (GRCh38)
Location 2:56123219-56123241
Sequence CTTGGCCAAGAGCTGGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930866064_930866070 7 Left 930866064 2:56123219-56123241 CCTTGCCCCAGCTCTTGGCCAAG No data
Right 930866070 2:56123249-56123271 TGAATAAACTTACAGATCACTGG No data
930866064_930866072 15 Left 930866064 2:56123219-56123241 CCTTGCCCCAGCTCTTGGCCAAG No data
Right 930866072 2:56123257-56123279 CTTACAGATCACTGGACCTTGGG No data
930866064_930866071 14 Left 930866064 2:56123219-56123241 CCTTGCCCCAGCTCTTGGCCAAG No data
Right 930866071 2:56123256-56123278 ACTTACAGATCACTGGACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930866064 Original CRISPR CTTGGCCAAGAGCTGGGGCA AGG (reversed) Intergenic
No off target data available for this crispr