ID: 930866986

View in Genome Browser
Species Human (GRCh38)
Location 2:56131378-56131400
Sequence GGAGTTCCTAACTCACTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930866980_930866986 6 Left 930866980 2:56131349-56131371 CCAATCCTGGACCCTGTATAAGT No data
Right 930866986 2:56131378-56131400 GGAGTTCCTAACTCACTGCCAGG No data
930866977_930866986 27 Left 930866977 2:56131328-56131350 CCTGGGCTAAGGGCAGCAAGCCC No data
Right 930866986 2:56131378-56131400 GGAGTTCCTAACTCACTGCCAGG No data
930866979_930866986 7 Left 930866979 2:56131348-56131370 CCCAATCCTGGACCCTGTATAAG No data
Right 930866986 2:56131378-56131400 GGAGTTCCTAACTCACTGCCAGG No data
930866984_930866986 -5 Left 930866984 2:56131360-56131382 CCCTGTATAAGTAGGACTGGAGT No data
Right 930866986 2:56131378-56131400 GGAGTTCCTAACTCACTGCCAGG No data
930866982_930866986 1 Left 930866982 2:56131354-56131376 CCTGGACCCTGTATAAGTAGGAC No data
Right 930866986 2:56131378-56131400 GGAGTTCCTAACTCACTGCCAGG No data
930866985_930866986 -6 Left 930866985 2:56131361-56131383 CCTGTATAAGTAGGACTGGAGTT No data
Right 930866986 2:56131378-56131400 GGAGTTCCTAACTCACTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930866986 Original CRISPR GGAGTTCCTAACTCACTGCC AGG Intergenic
No off target data available for this crispr