ID: 930872848

View in Genome Browser
Species Human (GRCh38)
Location 2:56185008-56185030
Sequence GGGGGTGCCGACCGGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 3, 3: 7, 4: 99}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930872848_930872867 23 Left 930872848 2:56185008-56185030 CCCTTCTCCCGGTCGGCACCCCC 0: 1
1: 0
2: 3
3: 7
4: 99
Right 930872867 2:56185054-56185076 GTAACTTTTCCAAACTTCGGAGG 0: 1
1: 0
2: 0
3: 10
4: 78
930872848_930872866 20 Left 930872848 2:56185008-56185030 CCCTTCTCCCGGTCGGCACCCCC 0: 1
1: 0
2: 3
3: 7
4: 99
Right 930872866 2:56185051-56185073 TGTGTAACTTTTCCAAACTTCGG 0: 1
1: 0
2: 1
3: 23
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930872848 Original CRISPR GGGGGTGCCGACCGGGAGAA GGG (reversed) Intronic