ID: 930872866

View in Genome Browser
Species Human (GRCh38)
Location 2:56185051-56185073
Sequence TGTGTAACTTTTCCAAACTT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 256}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930872858_930872866 -7 Left 930872858 2:56185035-56185057 CCCAGTCCCCAGCCCCTGTGTAA 0: 1
1: 0
2: 0
3: 29
4: 289
Right 930872866 2:56185051-56185073 TGTGTAACTTTTCCAAACTTCGG 0: 1
1: 0
2: 1
3: 23
4: 256
930872852_930872866 2 Left 930872852 2:56185026-56185048 CCCCCTACCCCCAGTCCCCAGCC 0: 1
1: 1
2: 18
3: 188
4: 1528
Right 930872866 2:56185051-56185073 TGTGTAACTTTTCCAAACTTCGG 0: 1
1: 0
2: 1
3: 23
4: 256
930872846_930872866 24 Left 930872846 2:56185004-56185026 CCTCCCCTTCTCCCGGTCGGCAC 0: 1
1: 0
2: 1
3: 20
4: 132
Right 930872866 2:56185051-56185073 TGTGTAACTTTTCCAAACTTCGG 0: 1
1: 0
2: 1
3: 23
4: 256
930872859_930872866 -8 Left 930872859 2:56185036-56185058 CCAGTCCCCAGCCCCTGTGTAAC 0: 1
1: 0
2: 1
3: 38
4: 388
Right 930872866 2:56185051-56185073 TGTGTAACTTTTCCAAACTTCGG 0: 1
1: 0
2: 1
3: 23
4: 256
930872851_930872866 12 Left 930872851 2:56185016-56185038 CCGGTCGGCACCCCCTACCCCCA 0: 1
1: 0
2: 4
3: 31
4: 346
Right 930872866 2:56185051-56185073 TGTGTAACTTTTCCAAACTTCGG 0: 1
1: 0
2: 1
3: 23
4: 256
930872857_930872866 -6 Left 930872857 2:56185034-56185056 CCCCAGTCCCCAGCCCCTGTGTA 0: 1
1: 0
2: 2
3: 64
4: 712
Right 930872866 2:56185051-56185073 TGTGTAACTTTTCCAAACTTCGG 0: 1
1: 0
2: 1
3: 23
4: 256
930872849_930872866 19 Left 930872849 2:56185009-56185031 CCTTCTCCCGGTCGGCACCCCCT 0: 1
1: 0
2: 2
3: 8
4: 129
Right 930872866 2:56185051-56185073 TGTGTAACTTTTCCAAACTTCGG 0: 1
1: 0
2: 1
3: 23
4: 256
930872847_930872866 21 Left 930872847 2:56185007-56185029 CCCCTTCTCCCGGTCGGCACCCC 0: 1
1: 0
2: 2
3: 6
4: 140
Right 930872866 2:56185051-56185073 TGTGTAACTTTTCCAAACTTCGG 0: 1
1: 0
2: 1
3: 23
4: 256
930872854_930872866 0 Left 930872854 2:56185028-56185050 CCCTACCCCCAGTCCCCAGCCCC 0: 1
1: 2
2: 27
3: 246
4: 1744
Right 930872866 2:56185051-56185073 TGTGTAACTTTTCCAAACTTCGG 0: 1
1: 0
2: 1
3: 23
4: 256
930872850_930872866 13 Left 930872850 2:56185015-56185037 CCCGGTCGGCACCCCCTACCCCC 0: 1
1: 0
2: 1
3: 23
4: 256
Right 930872866 2:56185051-56185073 TGTGTAACTTTTCCAAACTTCGG 0: 1
1: 0
2: 1
3: 23
4: 256
930872848_930872866 20 Left 930872848 2:56185008-56185030 CCCTTCTCCCGGTCGGCACCCCC 0: 1
1: 0
2: 3
3: 7
4: 99
Right 930872866 2:56185051-56185073 TGTGTAACTTTTCCAAACTTCGG 0: 1
1: 0
2: 1
3: 23
4: 256
930872845_930872866 25 Left 930872845 2:56185003-56185025 CCCTCCCCTTCTCCCGGTCGGCA 0: 1
1: 0
2: 0
3: 11
4: 163
Right 930872866 2:56185051-56185073 TGTGTAACTTTTCCAAACTTCGG 0: 1
1: 0
2: 1
3: 23
4: 256
930872853_930872866 1 Left 930872853 2:56185027-56185049 CCCCTACCCCCAGTCCCCAGCCC 0: 1
1: 0
2: 29
3: 235
4: 1692
Right 930872866 2:56185051-56185073 TGTGTAACTTTTCCAAACTTCGG 0: 1
1: 0
2: 1
3: 23
4: 256
930872856_930872866 -5 Left 930872856 2:56185033-56185055 CCCCCAGTCCCCAGCCCCTGTGT 0: 1
1: 1
2: 7
3: 79
4: 665
Right 930872866 2:56185051-56185073 TGTGTAACTTTTCCAAACTTCGG 0: 1
1: 0
2: 1
3: 23
4: 256
930872855_930872866 -1 Left 930872855 2:56185029-56185051 CCTACCCCCAGTCCCCAGCCCCT 0: 1
1: 10
2: 35
3: 347
4: 2129
Right 930872866 2:56185051-56185073 TGTGTAACTTTTCCAAACTTCGG 0: 1
1: 0
2: 1
3: 23
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930872866 Original CRISPR TGTGTAACTTTTCCAAACTT CGG Intronic