ID: 930872867

View in Genome Browser
Species Human (GRCh38)
Location 2:56185054-56185076
Sequence GTAACTTTTCCAAACTTCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 78}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930872856_930872867 -2 Left 930872856 2:56185033-56185055 CCCCCAGTCCCCAGCCCCTGTGT 0: 1
1: 1
2: 7
3: 79
4: 665
Right 930872867 2:56185054-56185076 GTAACTTTTCCAAACTTCGGAGG 0: 1
1: 0
2: 0
3: 10
4: 78
930872860_930872867 -10 Left 930872860 2:56185041-56185063 CCCCAGCCCCTGTGTAACTTTTC 0: 1
1: 0
2: 1
3: 15
4: 279
Right 930872867 2:56185054-56185076 GTAACTTTTCCAAACTTCGGAGG 0: 1
1: 0
2: 0
3: 10
4: 78
930872857_930872867 -3 Left 930872857 2:56185034-56185056 CCCCAGTCCCCAGCCCCTGTGTA 0: 1
1: 0
2: 2
3: 64
4: 712
Right 930872867 2:56185054-56185076 GTAACTTTTCCAAACTTCGGAGG 0: 1
1: 0
2: 0
3: 10
4: 78
930872851_930872867 15 Left 930872851 2:56185016-56185038 CCGGTCGGCACCCCCTACCCCCA 0: 1
1: 0
2: 4
3: 31
4: 346
Right 930872867 2:56185054-56185076 GTAACTTTTCCAAACTTCGGAGG 0: 1
1: 0
2: 0
3: 10
4: 78
930872846_930872867 27 Left 930872846 2:56185004-56185026 CCTCCCCTTCTCCCGGTCGGCAC 0: 1
1: 0
2: 1
3: 20
4: 132
Right 930872867 2:56185054-56185076 GTAACTTTTCCAAACTTCGGAGG 0: 1
1: 0
2: 0
3: 10
4: 78
930872845_930872867 28 Left 930872845 2:56185003-56185025 CCCTCCCCTTCTCCCGGTCGGCA 0: 1
1: 0
2: 0
3: 11
4: 163
Right 930872867 2:56185054-56185076 GTAACTTTTCCAAACTTCGGAGG 0: 1
1: 0
2: 0
3: 10
4: 78
930872848_930872867 23 Left 930872848 2:56185008-56185030 CCCTTCTCCCGGTCGGCACCCCC 0: 1
1: 0
2: 3
3: 7
4: 99
Right 930872867 2:56185054-56185076 GTAACTTTTCCAAACTTCGGAGG 0: 1
1: 0
2: 0
3: 10
4: 78
930872849_930872867 22 Left 930872849 2:56185009-56185031 CCTTCTCCCGGTCGGCACCCCCT 0: 1
1: 0
2: 2
3: 8
4: 129
Right 930872867 2:56185054-56185076 GTAACTTTTCCAAACTTCGGAGG 0: 1
1: 0
2: 0
3: 10
4: 78
930872853_930872867 4 Left 930872853 2:56185027-56185049 CCCCTACCCCCAGTCCCCAGCCC 0: 1
1: 0
2: 29
3: 235
4: 1692
Right 930872867 2:56185054-56185076 GTAACTTTTCCAAACTTCGGAGG 0: 1
1: 0
2: 0
3: 10
4: 78
930872855_930872867 2 Left 930872855 2:56185029-56185051 CCTACCCCCAGTCCCCAGCCCCT 0: 1
1: 10
2: 35
3: 347
4: 2129
Right 930872867 2:56185054-56185076 GTAACTTTTCCAAACTTCGGAGG 0: 1
1: 0
2: 0
3: 10
4: 78
930872854_930872867 3 Left 930872854 2:56185028-56185050 CCCTACCCCCAGTCCCCAGCCCC 0: 1
1: 2
2: 27
3: 246
4: 1744
Right 930872867 2:56185054-56185076 GTAACTTTTCCAAACTTCGGAGG 0: 1
1: 0
2: 0
3: 10
4: 78
930872852_930872867 5 Left 930872852 2:56185026-56185048 CCCCCTACCCCCAGTCCCCAGCC 0: 1
1: 1
2: 18
3: 188
4: 1528
Right 930872867 2:56185054-56185076 GTAACTTTTCCAAACTTCGGAGG 0: 1
1: 0
2: 0
3: 10
4: 78
930872847_930872867 24 Left 930872847 2:56185007-56185029 CCCCTTCTCCCGGTCGGCACCCC 0: 1
1: 0
2: 2
3: 6
4: 140
Right 930872867 2:56185054-56185076 GTAACTTTTCCAAACTTCGGAGG 0: 1
1: 0
2: 0
3: 10
4: 78
930872859_930872867 -5 Left 930872859 2:56185036-56185058 CCAGTCCCCAGCCCCTGTGTAAC 0: 1
1: 0
2: 1
3: 38
4: 388
Right 930872867 2:56185054-56185076 GTAACTTTTCCAAACTTCGGAGG 0: 1
1: 0
2: 0
3: 10
4: 78
930872850_930872867 16 Left 930872850 2:56185015-56185037 CCCGGTCGGCACCCCCTACCCCC 0: 1
1: 0
2: 1
3: 23
4: 256
Right 930872867 2:56185054-56185076 GTAACTTTTCCAAACTTCGGAGG 0: 1
1: 0
2: 0
3: 10
4: 78
930872858_930872867 -4 Left 930872858 2:56185035-56185057 CCCAGTCCCCAGCCCCTGTGTAA 0: 1
1: 0
2: 0
3: 29
4: 289
Right 930872867 2:56185054-56185076 GTAACTTTTCCAAACTTCGGAGG 0: 1
1: 0
2: 0
3: 10
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930872867 Original CRISPR GTAACTTTTCCAAACTTCGG AGG Intronic