ID: 930875418

View in Genome Browser
Species Human (GRCh38)
Location 2:56210179-56210201
Sequence TGTAATCTATGTACTACATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 143}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930875418 Original CRISPR TGTAATCTATGTACTACATG AGG Intronic
901882998 1:12204916-12204938 TGTAATCTCAGTACTTCAGGAGG + Intronic
906788765 1:48640291-48640313 TCTAATCTGTGAACTCCATGAGG + Intronic
910310646 1:85820258-85820280 TTTACTCTATGTACTTTATGTGG - Intronic
914337672 1:146730418-146730440 TGAAATGTATGGACTACAAGAGG - Intergenic
915452000 1:156012124-156012146 TTTAATATATGTTCTCCATGGGG - Intronic
918054504 1:181007769-181007791 TCTAATCTATTTACTATATTAGG + Intronic
918306006 1:183246817-183246839 TCTAATCTATGTTCTCCAGGTGG - Intergenic
918856898 1:189767353-189767375 TGTAGTCTATGTACTGTATTAGG - Intergenic
923885847 1:238154631-238154653 TATAATTTATGTAATACATAGGG - Intergenic
1066456398 10:35575854-35575876 TGTAACCTCTGAAGTACATGTGG - Intergenic
1068503551 10:57870248-57870270 TATTATTTATGTACTGCATGAGG + Intergenic
1068774546 10:60856115-60856137 TGCAATCCATGGGCTACATGAGG - Intergenic
1073827583 10:107342331-107342353 GGAAATCTATGTAATAAATGTGG + Intergenic
1074629024 10:115229021-115229043 TGTAATCTCAGCACTACAGGAGG - Intronic
1074742112 10:116495402-116495424 TTTAATCTATGTATTACTTTGGG + Intergenic
1080245235 11:30172635-30172657 TGTAATTTATGTACTAAATATGG - Intergenic
1080313129 11:30917937-30917959 TGTAATAGAAGTATTACATGTGG + Intronic
1081005314 11:37729049-37729071 TGTAATTTACTTACTACATAAGG + Intergenic
1081458632 11:43250302-43250324 TGTAATCAATCTACCACATTGGG + Intergenic
1082038980 11:47669322-47669344 TGTAATCTAAGTACTTTAAGAGG - Intronic
1082221409 11:49642676-49642698 TATAATATATCTAATACATGGGG - Intergenic
1086627632 11:88976476-88976498 TATAATATATCTAATACATGGGG + Intronic
1087912313 11:103768171-103768193 TGTAAACTATGTGCTTAATGAGG - Intergenic
1098647156 12:72917681-72917703 TGTAATCTATTTCATGCATGTGG + Intergenic
1100417914 12:94397869-94397891 GGTAATATATACACTACATGTGG - Intronic
1101299710 12:103466651-103466673 TGCAATCAGTGTACCACATGGGG - Intronic
1104197227 12:126552298-126552320 TGCAATCTCTGAACTACATTTGG + Intergenic
1104362028 12:128142630-128142652 TGTAATCTCTGCACTTCAGGAGG - Intergenic
1104739532 12:131163196-131163218 TATTACCTATGTGCTACATGTGG + Intergenic
1105645188 13:22310572-22310594 TGTAAACTATGTAGTGTATGTGG + Intergenic
1107452138 13:40519337-40519359 TGTAATATATGTAAAACACGAGG - Intergenic
1107713835 13:43179010-43179032 TGTTATATATGTACAACATAAGG + Intergenic
1109586358 13:64409804-64409826 TGTAAGCTGTGCACTACAAGGGG + Intergenic
1110615737 13:77540135-77540157 TGTAATCTCTCTAATCCATGTGG - Intronic
1116763632 14:49044797-49044819 TGTAAGCAATGTGCTACAAGAGG + Intergenic
1122498940 14:102181557-102181579 TGTAATCTAAGTCTTACATCAGG - Intronic
1125556885 15:40593287-40593309 TGTAATTCATGTAAAACATGTGG + Intergenic
1127352306 15:58165538-58165560 TGTAATGTATTTACTACAATTGG + Intronic
1131964140 15:97820812-97820834 TGTAAACTATGCACTTTATGTGG - Intergenic
1132168300 15:99619745-99619767 TGCATTATATGTACCACATGAGG - Intronic
1135940623 16:26818819-26818841 TGTAATATATGTGGTACATAAGG + Intergenic
1139111150 16:63892553-63892575 TATAATATATGTACTGCCTGAGG - Intergenic
1139996609 16:70986910-70986932 TGAAATGTATGGACTACAAGAGG + Intronic
1146750753 17:35376852-35376874 TGAAATTTATATAATACATGAGG + Intergenic
1147551772 17:41448178-41448200 TGTAATCCATGTACCACACCTGG - Intergenic
1149045127 17:52236235-52236257 AGTAATCGATGGGCTACATGAGG + Intergenic
1151882120 17:76902347-76902369 TGTAATGTGTGTACTGGATGGGG + Intronic
1155740673 18:29284345-29284367 TGTAAGCCAGGTAATACATGAGG - Intergenic
1155815923 18:30309927-30309949 TGGAATTTATATACTTCATGTGG - Intergenic
1157197075 18:45628187-45628209 TGTAATCTCAGTACTTCAGGAGG + Intronic
1162208908 19:9076241-9076263 TGTAATCTCTGTACTTTAGGAGG + Intergenic
1165789845 19:38484708-38484730 TGTAATCTAAGCACTTCAGGAGG + Intronic
1166569958 19:43788827-43788849 TGTAATCTCAGTACTTCAGGAGG - Intergenic
1168362982 19:55758418-55758440 TATAATATATTTAATACATGAGG + Intergenic
1168363937 19:55768418-55768440 TATAATATATTTAATACATGAGG + Intergenic
925079334 2:1050499-1050521 TGTATTCTCTGTACTCCATTGGG + Intronic
926179163 2:10625259-10625281 TGTAAACTATGAACTTCAGGTGG + Intronic
927223674 2:20739685-20739707 TATATACTATGTACTATATGCGG + Intronic
927238034 2:20895578-20895600 TGTAATCTAAGCACTTCAAGAGG + Intergenic
927492899 2:23532318-23532340 TGTTGTCTATGTACTGCAGGAGG - Intronic
929056517 2:37881653-37881675 TGCAAGCTGTGTGCTACATGTGG + Intergenic
930749883 2:54924364-54924386 TGTCATCTATTTACTATTTGGGG + Intronic
930831423 2:55747841-55747863 TTTAATCTATAAACTACATTGGG - Intergenic
930875418 2:56210179-56210201 TGTAATCTATGTACTACATGAGG + Intronic
931562689 2:63579715-63579737 TCTAATCTATCTACTCCATTTGG - Intronic
935970045 2:108522409-108522431 AGTAATATATGTATTACATTGGG + Intergenic
936420126 2:112355455-112355477 AGTAATATATGTATTACATTGGG - Intergenic
937695906 2:124808347-124808369 TGTAATCTCAGTACTTCAGGAGG + Intronic
938709910 2:133967332-133967354 TGTAATCTCAGCACTTCATGAGG - Intergenic
939724050 2:145692306-145692328 TGTAATATATTTACTAAATAAGG - Intergenic
940306237 2:152230292-152230314 TGTTAACTATGTACAAAATGTGG + Intergenic
940560227 2:155285979-155286001 TATAATAGATGTATTACATGAGG + Intergenic
942510391 2:176692861-176692883 TGTCAACTATGTACTACTTTGGG + Intergenic
943337864 2:186640829-186640851 TGTAATATATGTACCAAATAGGG - Intronic
944466015 2:200000325-200000347 TGTAATCTCTCTACTGGATGAGG + Intronic
947001168 2:225458197-225458219 TGTACTCTGCGTACTACAGGTGG + Intronic
948656304 2:239478683-239478705 TGTAATCTCAGTACTTCAAGAGG + Intergenic
1169547998 20:6670612-6670634 AGTATTCTAGGTATTACATGTGG + Intergenic
1169858583 20:10129182-10129204 TGTAATTAATCTACTACCTGTGG - Intergenic
1178625421 21:34213397-34213419 TGTAATCTCAGTACTTCAGGAGG - Intergenic
1178993627 21:37376807-37376829 TTTAAACTATATACTACTTGTGG - Intronic
1179337442 21:40470923-40470945 TGTAATTTGTCTTCTACATGTGG - Intronic
953312697 3:41894999-41895021 GGGAAGCTATGTGCTACATGAGG + Intronic
956212597 3:66817003-66817025 TGTAATCTCAGTACTTCAGGAGG - Intergenic
956632503 3:71330769-71330791 TGTAATATAAGTTCTACCTGAGG - Intronic
957803121 3:85111388-85111410 TGTAATCTTTGCAATATATGAGG + Intronic
958685996 3:97395223-97395245 TGTTATCTATTTCCTGCATGTGG - Intronic
958723887 3:97879495-97879517 TCTAAGCTATGTACTTCTTGAGG + Intronic
959484906 3:106916162-106916184 TGTAGTCCATGTATTACCTGGGG + Intergenic
963679562 3:148356961-148356983 TGTAATTTATTTACTATTTGGGG + Intergenic
964509017 3:157429554-157429576 CTTATTCTATGAACTACATGTGG - Intronic
964607878 3:158577230-158577252 TGTATTCTATGTACAAGATGTGG + Intronic
965019637 3:163212601-163212623 TGTAATCTAAGCACCACATTGGG - Intergenic
965776613 3:172238409-172238431 TGTAATCTCTGTACTTCAGGAGG - Intronic
965955689 3:174366218-174366240 TGTAAAGTTTGTATTACATGTGG - Intergenic
970124658 4:12795763-12795785 AGTAATCTATGAAATAAATGTGG - Intergenic
971093705 4:23373885-23373907 TATAATCCATGTACTACACTAGG + Intergenic
971771936 4:30908304-30908326 TTTAATCAATGTACTCCATAGGG - Intronic
975543615 4:75538900-75538922 TGTAATCTAAGAACCACATGAGG + Intronic
978188576 4:105886684-105886706 TGTAAACTATGCACTTCAGGTGG - Intronic
978936368 4:114381966-114381988 TTTAAACTAGCTACTACATGAGG - Intergenic
980821984 4:138029223-138029245 TGAAATGTATGTACTAGGTGAGG - Intergenic
983686923 4:170421333-170421355 TATAAACTATGTACTCCAGGTGG + Intergenic
986818454 5:11438438-11438460 TCTAATATATGAACTACACGTGG + Intronic
987328564 5:16834577-16834599 TGTAATCTTAGTACCACACGTGG - Intronic
988833488 5:35009337-35009359 TGTAATCTTAGTACTTCAGGAGG + Intronic
989403716 5:41037220-41037242 TGTAATCTCAGCACTTCATGAGG - Intronic
990490413 5:56297831-56297853 TGTAATCTCTGTACTGTATTGGG - Intergenic
1000700839 5:164447550-164447572 TGTAATCTATATTATACATATGG + Intergenic
1003431249 6:6039928-6039950 TGTAAGCTGTGTACCAAATGAGG - Intergenic
1004356698 6:14935363-14935385 TGTAATCTAAGCACTTCAGGAGG + Intergenic
1004433286 6:15565987-15566009 TGTGATCTTTCTACTGCATGAGG - Intronic
1006125663 6:31836233-31836255 TATAATCCATGTACCACAGGTGG + Intronic
1006226416 6:32540513-32540535 TGTATTCTTGGTAATACATGTGG + Intergenic
1006536722 6:34705121-34705143 TGCAATCTAAGTTCTACCTGGGG + Intergenic
1006857283 6:37143556-37143578 TTTAATATATGTACAACACGTGG + Intergenic
1014994771 6:128128232-128128254 AGTAATACATGTAATACATGAGG + Intronic
1016119063 6:140325650-140325672 TGTCACCTATGTACTAAGTGTGG + Intergenic
1016198022 6:141369568-141369590 TGTAATCTATATATTACTTTGGG + Intergenic
1018350378 6:162952339-162952361 AGTAATCTATATACAACAAGGGG - Intronic
1019078393 6:169410299-169410321 TGCTATCTATTAACTACATGAGG + Intergenic
1020612211 7:10412610-10412632 TGTAATCTATGACCAACAGGTGG - Intergenic
1022434533 7:30369225-30369247 TGTAATCTTTGAAATACATATGG - Intronic
1026104522 7:67410398-67410420 TGTACCCTATGGACTACCTGTGG + Intergenic
1028820678 7:95208228-95208250 TGTAATCTATGTCATAAATCAGG - Intronic
1028859578 7:95633632-95633654 TGTAATTTATGTTATGCATGAGG + Intergenic
1029404866 7:100368620-100368642 TGTAATCTCTGTGCTTCAGGAGG + Intronic
1030026017 7:105325599-105325621 TGTAATCTAAGTACTTTAGGAGG + Intronic
1030875843 7:114812367-114812389 TGTAATCTATGGACTTCGGGTGG - Intergenic
1033199117 7:139353292-139353314 TGTAATTTATGAACTAAATATGG - Intronic
1035942710 8:3920945-3920967 TGTAATCTAGATATGACATGAGG + Intronic
1036407734 8:8470030-8470052 TGTAATCTCAGCACTACAGGAGG - Intergenic
1039157521 8:34578396-34578418 TGTAATATCAGTACTTCATGAGG + Intergenic
1041473540 8:58237465-58237487 TGTTACCTATTTAATACATGTGG + Intergenic
1044818306 8:96135640-96135662 TCTAATCTATTTACCACATTGGG + Intergenic
1048238277 8:132714524-132714546 TGTAAGGTATGTTATACATGTGG - Intronic
1051621968 9:19059951-19059973 TGTAATCGACGTACTAAGTGTGG - Intronic
1051866061 9:21684282-21684304 ATTACTCTATGTATTACATGAGG + Intergenic
1056991531 9:91416189-91416211 TGTAATCTGTTTTCAACATGAGG + Intronic
1057454868 9:95198981-95199003 TGTAATCTCAGTACTGCAAGAGG - Intronic
1058368652 9:104238524-104238546 TGTCACCTATGTGCTACCTGAGG + Intergenic
1187145241 X:16631090-16631112 TGTAATCTCAGTACTTCAGGAGG + Intronic
1189077607 X:37933627-37933649 TGCAATCTATGTACCACCTCAGG - Intronic
1193667879 X:84346009-84346031 TGAATTCTATGTAATATATGTGG + Intronic
1198476797 X:137002152-137002174 TGTAATGTATGTCCTGCTTGGGG - Intergenic
1198691878 X:139293307-139293329 TGTAATGTACGTTATACATGAGG - Intergenic
1202349615 Y:23973844-23973866 TCTAATGAATGTACTACATCTGG + Intergenic
1202521160 Y:25696260-25696282 TCTAATGAATGTACTACATCTGG - Intergenic