ID: 930875789

View in Genome Browser
Species Human (GRCh38)
Location 2:56214080-56214102
Sequence CGGATAAGTACAGCCTTCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 38}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930875789 Original CRISPR CGGATAAGTACAGCCTTCTA AGG Intronic
909089539 1:71208067-71208089 GGAATAAGTACTGCCTTCTCTGG - Intergenic
911760190 1:101605191-101605213 CAGAAATGTACAACCTTCTATGG - Intergenic
921802515 1:219417792-219417814 CGGCAAAGTGCAGCCTTCCAAGG + Intergenic
1065274432 10:24071635-24071657 CGGTTAAGTCCAGCCTAGTATGG + Intronic
1100862411 12:98820318-98820340 CTGATTAGTACAGCTTTATAAGG - Intronic
1114282714 14:21208562-21208584 CAGATAAGTACAGGCTTTTTGGG - Intergenic
1120588798 14:86349762-86349784 TAGATAAGTCCTGCCTTCTAGGG - Intergenic
1159741810 18:72180923-72180945 CTGCTAAGGACAGCCTCCTATGG + Intergenic
1161584861 19:5100016-5100038 CGGATGGGTGCAGCCTTCGAAGG - Intronic
1161762317 19:6183251-6183273 AGAATAACTACAGGCTTCTAAGG + Exonic
1162522028 19:11186798-11186820 CGGATAGGGACAGCCTTTTTTGG + Intronic
930875789 2:56214080-56214102 CGGATAAGTACAGCCTTCTAAGG + Intronic
937232073 2:120404071-120404093 TCGAAAAGTCCAGCCTTCTAAGG + Intergenic
940487435 2:154313772-154313794 AGAATAAGTACTACCTTCTAGGG + Intronic
1170278009 20:14614508-14614530 AGGATAATTACAGCCATTTACGG - Intronic
1172901783 20:38340484-38340506 GGGATAAGCACAGCCTTCCTGGG + Intergenic
963865769 3:150359481-150359503 AGGTTAGGTACAGGCTTCTAAGG - Intergenic
967445674 3:189563883-189563905 AGGATAAGTACAACCTACAAGGG + Intergenic
970840959 4:20469002-20469024 CAGACAACTACAGGCTTCTAAGG + Intronic
975735251 4:77374083-77374105 GGGGTAAGGACAGCCTTCTTTGG - Intronic
978327113 4:107571857-107571879 TGGATAATTATAGCCTTTTAAGG - Intergenic
979107913 4:116711087-116711109 GGCAAAGGTACAGCCTTCTAAGG - Intergenic
983355284 4:166648998-166649020 TGGACACATACAGCCTTCTAAGG - Intergenic
990105751 5:52257707-52257729 CATATAAGCACAGCCTTGTAGGG - Intergenic
994983827 5:106909769-106909791 GGGCTAATTACAGCCTTCAATGG - Intergenic
999223586 5:150001177-150001199 CGGGTAAGTCCCGCCTTCGAGGG + Exonic
1003217134 6:4124423-4124445 CTGATGATTGCAGCCTTCTAGGG - Intronic
1012888878 6:104876666-104876688 TGGGGAAGCACAGCCTTCTATGG - Intergenic
1031338177 7:120563890-120563912 GGGATAAGTAAAGGCTTCAAGGG - Intronic
1034024713 7:147688183-147688205 CTGATAAGAACAGCCTTCCCAGG - Intronic
1043745288 8:83867698-83867720 AGGATAAGTACAGCATACAATGG + Intergenic
1052021929 9:23535134-23535156 CGGTTCTGTAGAGCCTTCTAAGG + Intergenic
1054774776 9:69115954-69115976 AGGATAAGTAGATCCTTTTAAGG + Intergenic
1060718732 9:125959220-125959242 GGGATACATACAGTCTTCTAGGG + Intronic
1186310814 X:8316773-8316795 CGAATAACTAAAGCCTTCTGCGG + Intergenic
1188459877 X:30412121-30412143 TGGATAAGGATAGACTTCTAGGG + Intergenic
1194797030 X:98224672-98224694 TGGAAAAGTAAAGCCTTTTATGG - Intergenic
1197500566 X:127236612-127236634 CAGATAAGTACAAACTTCTTTGG - Intergenic
1202042464 Y:20699507-20699529 CAGATAAGCACAGACTTCTTGGG - Intergenic