ID: 930877999

View in Genome Browser
Species Human (GRCh38)
Location 2:56241482-56241504
Sequence TCAGAGGCCCAGAAAGATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 493
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 449}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930877999 Original CRISPR TCAGAGGCCCAGAAAGATAA TGG (reversed) Intronic
900153793 1:1195293-1195315 TCTGAGGAACAGAAAGAAAAAGG - Intronic
900889430 1:5438731-5438753 TCAGAGGCCTAGGAGGAAAAAGG - Intergenic
900932391 1:5745611-5745633 TCTGAGGCTCAGAGAGGTAAAGG + Intergenic
902088921 1:13886890-13886912 TCAGAACCCAAGCAAGATAAAGG - Intergenic
902910033 1:19589038-19589060 AAAGAGGCCCTGAAAGAGAAGGG - Intergenic
903046501 1:20568072-20568094 CCAGAGGCCAGGAAAGATACAGG - Intergenic
903326098 1:22569445-22569467 GCAGAGGCCCAGAGAGGTCAAGG + Intronic
904619573 1:31767090-31767112 ACAGAGGCCCAGAAAGCTGAAGG - Intergenic
904921164 1:34009440-34009462 GTAAAGGCCCAGAAAGATCAGGG - Intronic
905044005 1:34982357-34982379 TCAGAGGACAAGAAAGAAACGGG + Intronic
905426429 1:37888912-37888934 TCAAAGGCCCAGAATGCCAAGGG + Intronic
905535350 1:38717149-38717171 TCTGAGGCTCAGAAACATAAAGG + Intergenic
905657351 1:39693171-39693193 TGGGAGGCCCAGAATGAGAAGGG - Intronic
906015242 1:42571144-42571166 CCACAGGCCAAGAAAGGTAAAGG - Intronic
906711149 1:47930808-47930830 ACTGAGGCCCAGAAAGGAAAAGG + Intronic
906845175 1:49183990-49184012 ACTGAGGCCCAGAAAGGTGAAGG + Intronic
907569030 1:55466146-55466168 TCAGAGGCTCTGAAACTTAAGGG - Intergenic
907785683 1:57610422-57610444 TAAGAGGCCCAGAGTGATTATGG + Intronic
907830784 1:58062269-58062291 ACAGAGGCTCAGAAAGCTACAGG + Intronic
908325680 1:63021204-63021226 ACAGAGGCTCAGACAGTTAAAGG + Intergenic
908425706 1:64004931-64004953 AAAGAGGTCGAGAAAGATAAGGG + Intronic
908661390 1:66439286-66439308 TTAGAGGCCCTGGAAGATTATGG + Intergenic
910122668 1:83807870-83807892 CCAGAAGCCCAGAAAGTTTAGGG + Intergenic
911115849 1:94246655-94246677 TCAGAGGGGCTGAAAGACAAGGG + Intronic
911179951 1:94851516-94851538 TAAGAGACACAGAAAGAAAAAGG - Intronic
911240874 1:95464541-95464563 TCAGAGGCCGGGAAGGATAGTGG - Intergenic
912195610 1:107393760-107393782 TCAGTGTTCCAGAAAGATTATGG + Intronic
912732897 1:112125402-112125424 ACATAGACTCAGAAAGATAAAGG - Intergenic
912869133 1:113287962-113287984 GAAGAGGCACAGAAAGAGAAAGG + Intergenic
913247056 1:116879178-116879200 ACAGATGCCCAGATAGCTAAGGG - Intergenic
915621633 1:157089742-157089764 TCACAGGCCCAGAGAGAAGAAGG - Intergenic
915727589 1:158028970-158028992 ACAGATGACCACAAAGATAAAGG - Intronic
916210596 1:162356791-162356813 GTAGAGGCCCAGAAAGGAAATGG - Intronic
918858490 1:189790556-189790578 TTAGAGAACCAGAGAGATAAAGG - Intergenic
921742859 1:218706438-218706460 TCACAGGCCCAGACAGAAAAGGG + Intergenic
924337262 1:242996632-242996654 GCAGAGGCCCAGAATAAGAAAGG + Intergenic
1063186062 10:3652887-3652909 TCAGGTGCCCAGAATGTTAAAGG - Intergenic
1063505252 10:6591953-6591975 ACTGAGGCCCAGAGAGATCATGG - Intergenic
1063886101 10:10580562-10580584 ACTGAGGCCCAGAAAAATGAAGG - Intergenic
1065079202 10:22111079-22111101 TCAGAGCACCAGAAAGATAATGG - Intergenic
1067191196 10:44069541-44069563 CCTGAGGCTCAGAAAGATTAAGG + Intergenic
1068083580 10:52347678-52347700 ACAGAGGGCCTGAAAGCTAAGGG + Intergenic
1068205097 10:53840092-53840114 TCTGATGCCCATAAAGAAAATGG + Intronic
1068496365 10:57789408-57789430 AGAGAGGACCAGAAAGAGAAGGG - Intergenic
1068562563 10:58531878-58531900 TCAGAGGAACAAAAAGAAAAAGG + Intronic
1069917790 10:71797990-71798012 TCAGAGGCTCAGATGGTTAAGGG + Intronic
1073084233 10:100878184-100878206 ACAGAGGCCCAGAGAGAGAGAGG - Intergenic
1073200632 10:101732294-101732316 ACAGAGGCTCAGAAAGATTAAGG - Intergenic
1074467155 10:113693435-113693457 TCAGAGGAACAAAAAGAAAAAGG - Intronic
1075287182 10:121196874-121196896 TATGAGGCCAAGAAAGAAAAAGG + Intergenic
1076489518 10:130848306-130848328 TCAGAGTCCCAGAAAAAGCAAGG + Intergenic
1078840233 11:15071183-15071205 TCAGAGGCTGAGAAGGGTAATGG + Intronic
1078945702 11:16066738-16066760 TCAGAGGCTAGGAAGGATAATGG + Intronic
1079194223 11:18311144-18311166 TCAAAGGCCTTAAAAGATAAAGG - Intronic
1079368854 11:19832901-19832923 TGAGAGAGCCAGAAAGATAATGG - Intronic
1079800430 11:24861328-24861350 TCAGAGTACCAGAAAAATATGGG + Intronic
1080229582 11:30004257-30004279 TCAGAGCCTAAGAAAGATATTGG + Intergenic
1080571300 11:33559453-33559475 ACCGAGGCCCAGAATGATCAAGG - Intronic
1081005371 11:37730207-37730229 TGAGAGGCCCAGAAAGCCAAAGG - Intergenic
1082251762 11:49990170-49990192 TCTGAGGAGCAGAAAGAGAAAGG - Intergenic
1083170784 11:60923000-60923022 TCAGAGACCCTGAAAGAGGAGGG + Exonic
1083410445 11:62488897-62488919 TCAAAGGCCCAGGAAGACAGGGG + Intronic
1084033954 11:66496844-66496866 ACAGAGGCCCAGAGAGGTAAAGG - Intronic
1084099188 11:66934196-66934218 TCCGAGGCCCTGCAAGATGAGGG - Intronic
1084999884 11:73022698-73022720 TCAATAGTCCAGAAAGATAAAGG + Intronic
1085198467 11:74686706-74686728 ACACAGGCCCAGCAAGGTAAAGG - Intergenic
1085973134 11:81618254-81618276 CCAGAGGCTGAGAAAGGTAAAGG + Intergenic
1086010569 11:82098294-82098316 TCTGAGGCTCAGAAATATGAAGG - Intergenic
1086167864 11:83800237-83800259 ACTGAGGCCCAGAGAGATGAAGG - Intronic
1088405783 11:109476812-109476834 TCAAAGGACCATAAATATAAGGG - Intergenic
1088849735 11:113695129-113695151 TCAGAGGCCAAGGAAGAGAGTGG + Intronic
1089025484 11:115265354-115265376 CCAGAGGCCCAGGAAGACTAAGG - Intronic
1089335735 11:117722361-117722383 TTAGAGGCTGGGAAAGATAAGGG + Intronic
1089902145 11:121997878-121997900 CCAGTTGCCCAGAAAGTTAATGG - Intergenic
1090269615 11:125376962-125376984 ATAGAGGCCCAGAAAGAGGAGGG - Intronic
1090438141 11:126703756-126703778 TCAGAGGGCAGGAAAGAGAATGG + Intronic
1090591743 11:128278479-128278501 TCAGAGTCCCAGAAGGAGAGGGG - Intergenic
1091633897 12:2182947-2182969 ACAGAGGCTCAGAAAGGTTAAGG - Intronic
1092769549 12:11884274-11884296 ACGGAGGCCCAGAAAGATGGAGG - Intronic
1092771613 12:11902343-11902365 TCAGAGGCCCAGCGGGATGAGGG + Intergenic
1092902063 12:13069178-13069200 GCAGAGGCCCAGAGACAGAAAGG + Intronic
1093324117 12:17752395-17752417 ACAGAAGCACAGAAGGATAATGG - Intergenic
1094354166 12:29559800-29559822 TCAGATACCCAGAGAGAGAAAGG - Intronic
1094640668 12:32271979-32272001 ACTGAGGCCCAGAGAGATTAAGG - Intronic
1096154174 12:49332713-49332735 TCAGAGGCCCAGAAAGCCGGAGG - Exonic
1097039140 12:56144055-56144077 CCAGGGGCCCAGAAGGATAAAGG - Intronic
1097963854 12:65558323-65558345 TTAGAGCCCCAGAAAGATTCAGG - Intergenic
1098506093 12:71252252-71252274 TCAGAGGAGCAAAAAGAAAAAGG + Intronic
1099726067 12:86429959-86429981 TCAGTGGAGCAGAAAGATAAAGG - Intronic
1101044343 12:100789111-100789133 TTAGAGGCTCAAAAATATAATGG + Intronic
1101640050 12:106581320-106581342 GCTGAGGCCCAGAACGATGAAGG + Intronic
1101736021 12:107463940-107463962 ACAGAGGCCCAGAGAGATGAGGG - Intronic
1102148401 12:110671655-110671677 TGTGTGGCCCGGAAAGATAAAGG - Intronic
1102465972 12:113131027-113131049 TCGGAGGCACAGACAGAGAAGGG + Intronic
1103204815 12:119120385-119120407 ACTGAGGCCCAGGAAGATGAAGG - Intronic
1103383000 12:120509468-120509490 TCAGAGGCTGACAAAGACAAGGG - Intronic
1103727162 12:123003702-123003724 TCAGAGGCTCAGAAAGGGATGGG - Intronic
1104351803 12:128050472-128050494 CCAGAGGCCAGGAAGGATAAGGG + Intergenic
1104381302 12:128310285-128310307 CCAGAGGCCAAGAAGGATAATGG + Intronic
1104710053 12:130979250-130979272 TCAGAGGTCCAGAAAGGTCCAGG + Intronic
1104873257 12:132015727-132015749 TCACAGGCCCGGAAAGAAAGAGG - Intronic
1105238485 13:18585952-18585974 CCAGAGGCCAGGAAAGATAGAGG - Intergenic
1106759341 13:32852361-32852383 GCACTGGCACAGAAAGATAAAGG + Intergenic
1106806792 13:33316909-33316931 TGAGAGGTCGAGAAAGAAAATGG - Intronic
1107903686 13:45043088-45043110 GTAGAGGGCCAGAAAGTTAAGGG + Intergenic
1108434922 13:50392425-50392447 TCAGAGGCTTAGCAGGATAAAGG - Intronic
1108605344 13:52031812-52031834 TCTGAGACTCAGAAAGATAAAGG - Exonic
1108715498 13:53074344-53074366 TTTGAGGCTCAGAGAGATAAGGG - Intergenic
1109758790 13:66798744-66798766 GCACAGGCACAGAAAGAAAATGG + Intronic
1109760484 13:66821304-66821326 TCAGAGGATCAGAAAGAAATAGG + Intronic
1110513662 13:76383021-76383043 TCTGAGGCCCAAAGAGATGATGG - Intergenic
1110880249 13:80562951-80562973 TGAGAGAACCAGAAACATAATGG - Intergenic
1111118180 13:83809416-83809438 TCAGAGATGCAGAAAGTTAAAGG + Intergenic
1111518868 13:89373060-89373082 TCAGAGGGGAAGAAAGAGAATGG + Intergenic
1112731545 13:102368136-102368158 TCAGTGGCCTAGTAATATAAAGG - Intronic
1112738937 13:102452516-102452538 TGAGAAGGCCAAAAAGATAATGG + Intergenic
1112819323 13:103312602-103312624 CCAAAGGCCAAGAAAGATAACGG - Intergenic
1115179835 14:30610715-30610737 TCATAGACCCAGAAAGACAGTGG + Intronic
1115344400 14:32326998-32327020 TCTGAAGCCCAGAAAGATAATGG - Intergenic
1115439430 14:33415123-33415145 GCAGAGCCCCAGAATTATAAAGG + Intronic
1115529987 14:34318181-34318203 TCAGAGGCCTAGAAAAGTGAGGG + Intronic
1116561797 14:46388788-46388810 CCAGAGGCTCAGAAGGATAGTGG + Intergenic
1116956597 14:50930013-50930035 AGAGAAGGCCAGAAAGATAAAGG - Intronic
1118374912 14:65168336-65168358 ACTGAGGCCCAGAAAGATCTTGG + Intergenic
1118440099 14:65804429-65804451 TCAGAGGCCCAGAAAGGAGGAGG - Intergenic
1118623307 14:67633906-67633928 ACAGAGACCCAGGAAGAGAAGGG - Intronic
1121578546 14:95008857-95008879 TCAGAGGCACAAAACGAGAAGGG + Intergenic
1121607427 14:95251617-95251639 ACTGAGGCTCAGAAAGGTAAAGG + Intronic
1121947170 14:98134415-98134437 ACTGAGGCCCAGAAGGCTAATGG + Intergenic
1122962704 14:105104057-105104079 AGGGAGTCCCAGAAAGATAAGGG + Intergenic
1202834544 14_GL000009v2_random:68047-68069 TCAGAGGCTCAGGAACAGAAGGG + Intergenic
1123825912 15:24081940-24081962 TCAGAGGCCCAGCAGCATAAGGG - Intergenic
1123989289 15:25671493-25671515 TCAGAGGCTCTGAAAGTGAAGGG + Intergenic
1124233031 15:27962360-27962382 TGAGAAGCTCAGAAAGATAGAGG - Intronic
1125257503 15:37782226-37782248 TCAGAGGGACTGAGAGATAAAGG - Intergenic
1125788400 15:42343305-42343327 TCAGAGGTCAAGAAACTTAATGG + Intronic
1127183576 15:56452460-56452482 CCAGACTCCCAGAAAGAAAATGG + Intronic
1127314634 15:57783185-57783207 TCAGAGTCCTTGAAAGATAAAGG + Intergenic
1127318277 15:57817790-57817812 TCAGAGGCCCAGAAGGAAGAGGG - Intergenic
1127578102 15:60312246-60312268 ACAAAGGCCCAGAAAGTTAAGGG + Intergenic
1127916082 15:63456478-63456500 CCTGAGGCCCAGAAAGAGGAAGG - Intergenic
1128619910 15:69140077-69140099 ACTGAGGCCCAGAGAGATCAAGG + Intergenic
1128706470 15:69840712-69840734 ACAGAGGTTCAGAAAGATTAAGG - Intergenic
1129165942 15:73777525-73777547 ACAGAGCCCCAGAAAGAACATGG - Intergenic
1129254843 15:74328409-74328431 TCTGAGGCTCAGAAAGGTGAAGG + Intronic
1129858701 15:78843570-78843592 GCAGAGGCCCAGAGAGGAAAGGG - Intronic
1130083606 15:80757580-80757602 TCAGAGGCCCAGAGAAATTAGGG - Intergenic
1130650926 15:85761690-85761712 TCCGAGGCCCTGAAAGGAAAAGG + Intronic
1130674077 15:85937089-85937111 TCACAGGCTCTGAAAGACAATGG - Intergenic
1130749827 15:86699528-86699550 TGAAAGGCCAAGAAAGATCAAGG - Intronic
1133379357 16:5316917-5316939 TCAGAGGAACAAAAAGGTAAAGG + Intergenic
1133609712 16:7422005-7422027 TCAGAGGCTCTGAGTGATAAAGG + Intronic
1134802468 16:17098285-17098307 TCTGAGGCCCAGAGAGATTAGGG + Intergenic
1134874057 16:17680558-17680580 TCTGAGGAACAGAAAGAAAAAGG - Intergenic
1135899541 16:26444208-26444230 ACAGAGGCCAAGAAAGGCAAAGG - Intergenic
1136343588 16:29661469-29661491 ACAGTGGCTCAGAAAGGTAACGG - Intergenic
1137382063 16:48008609-48008631 TAAGAAGGCCAGAAAGATCATGG - Intergenic
1137798594 16:51242309-51242331 ACTGAGGCCTAGAAAGAGAATGG - Intergenic
1137927445 16:52554067-52554089 TCAGGGGATCAGAAAGAAAAGGG - Intergenic
1138808811 16:60124367-60124389 TAAGAAGACAAGAAAGATAACGG + Intergenic
1138862997 16:60781861-60781883 TTTGAGGCTCAGAAAGATGACGG - Intergenic
1139142478 16:64284367-64284389 TCAGAGCCCCAGAAAAAGAGAGG + Intergenic
1140441532 16:74991685-74991707 ACAGAAGACTAGAAAGATAAAGG - Intronic
1140607902 16:76563302-76563324 TCAGAGACCTAGAAAGAGACTGG - Intronic
1140889169 16:79270506-79270528 TCAGAGGAGCAGAGAGATGATGG - Intergenic
1141344288 16:83231006-83231028 TCAGAGCCCGAGGAAGATGAAGG - Intronic
1143205404 17:5137049-5137071 TCAGAGGCCCTGGAAGATGGAGG + Intronic
1144195682 17:12892589-12892611 TCAGAGTCCCAGAAGAAGAAGGG - Intronic
1144267294 17:13583251-13583273 TCAGAGGCCCACCAATAAAAGGG - Intronic
1144533288 17:16061559-16061581 TCTGAGGCTGGGAAAGATAAAGG - Exonic
1144586156 17:16489118-16489140 TCAGAGCCTCAAAAAGATCAAGG + Intronic
1144613094 17:16742213-16742235 TTAGAGGCTGAGAAAGGTAAAGG - Intronic
1144737178 17:17561718-17561740 TGAGAGGCCCAGAGATATGAGGG + Intronic
1144785959 17:17831729-17831751 TCTGAGGCCCAGAAGGAGACAGG + Intronic
1144876445 17:18399742-18399764 TCAGAGGCCCTGGAAGATGGAGG + Intergenic
1145078619 17:19875996-19876018 ACAGAGGCCCAGAGAGGTGAAGG - Intergenic
1145132752 17:20372290-20372312 TTAGAGGCTGAGAAAGGTAAAGG - Intergenic
1145155781 17:20544678-20544700 TCAGAGGCCCTGGAAGATGGAGG - Intergenic
1145258870 17:21342978-21343000 ACAGAGGCCCAGGGAGCTAAGGG - Intergenic
1145317754 17:21745026-21745048 ACAGAGGCCCAGGGAGCTAAGGG + Intergenic
1146589470 17:34116260-34116282 ACAGAGGCCTAGAGAGAGAAAGG - Intronic
1146632947 17:34483852-34483874 CCAGAGGTCCAGAGAGAGAACGG - Intergenic
1147518159 17:41141890-41141912 TGTGAGGCCAAGAAAGATATTGG - Intergenic
1149160007 17:53681177-53681199 TGGGAGTCCCAGAAAGAGAAAGG - Intergenic
1149277198 17:55055161-55055183 TCAAAGGCCCAGGAACATAAGGG + Intronic
1149592766 17:57844334-57844356 AAAGAGGGCCACAAAGATAAAGG + Intronic
1149738405 17:59018923-59018945 TCAGTGGACCATAAATATAAGGG - Intronic
1153248395 18:3095988-3096010 TAAGAGGCCCAGAGTGATGAGGG + Intronic
1153253209 18:3142934-3142956 CCAGAGGTCAAGAAAAATAATGG + Intronic
1153729560 18:7995991-7996013 TCAGAAGCCCAGAAAAACCAAGG - Intronic
1154213012 18:12396026-12396048 AGAGAGGTCCAGAAAGATGAGGG + Intergenic
1154511878 18:15113805-15113827 CCAGAGGCCAGGAAAGATAGAGG - Intergenic
1155848543 18:30740280-30740302 TCAGAGGCTGAGAAGGAGAATGG + Intergenic
1156470068 18:37371829-37371851 TCAGGGGCCCAGGAAGAACAAGG + Intronic
1159075850 18:63681133-63681155 TTAGAGGCTGAGAAGGATAAAGG + Intronic
1159273798 18:66189178-66189200 ACAGAGGCAGAGAAAGATTAGGG + Intergenic
1161100809 19:2420673-2420695 TCAGAGTCCCAGAGAGGTTAAGG - Intronic
1161283298 19:3456957-3456979 ACTGAGGCCCAGAGAGACAAGGG + Intronic
1165948052 19:39457149-39457171 TCTGAGACCCAGAGAGATTAAGG - Intronic
1166184423 19:41130572-41130594 TCAGAGACCCAGAAAGAAAGAGG + Intergenic
1166302651 19:41921215-41921237 TCAGAGACCCAGAGAGATGGAGG + Intronic
1166516883 19:43453868-43453890 ACTGAGGCACAGAAAGATGATGG + Intergenic
1167315862 19:48762356-48762378 ACAGAGGCCCAGAGAGAGAGGGG + Intergenic
1167413929 19:49360809-49360831 ACAGAGACCCAGAGAGAGAAGGG + Intronic
1167424689 19:49423987-49424009 CGAGAGGCCCAGAAAGATCGAGG + Exonic
1167427660 19:49437714-49437736 GCAGAGACCCAGAGAGAGAAGGG + Intronic
1167471014 19:49676599-49676621 TGAGAGGCCCAGAGAGAGGAAGG - Intronic
1167475925 19:49700974-49700996 ACAGAGACCCAGAAAGAGAGGGG - Intronic
1167564772 19:50249329-50249351 ACAGAGACCCAGAGAGAGAAGGG - Intronic
1167631057 19:50626485-50626507 ACAGAGGCCCAGAGAGAGAGGGG + Intronic
1167631080 19:50626581-50626603 ACAGAGGCCCAGAAAGAGAGGGG + Intronic
1167631112 19:50626794-50626816 ACAGAGGCCCAGAGAGAGAGAGG + Intronic
1167689061 19:50974752-50974774 TGACAGGCCCAGAAACAGAAGGG + Intergenic
1167706516 19:51084326-51084348 AGAGAGACCCAGAAAGAGAAGGG + Intergenic
1168308723 19:55450497-55450519 ACAGAGACCCAGAAAGACAGGGG + Intergenic
1168308744 19:55450591-55450613 ACAGAGACCCAGAGAGAGAAGGG + Intergenic
1168308756 19:55450637-55450659 ACAGAGACCCAGAAAGACAGGGG + Intergenic
1168358145 19:55715112-55715134 TCAAATGCCCTGGAAGATAATGG - Exonic
1202638150 1_KI270706v1_random:59645-59667 TCAGAGGCTCAGGAACAGAAGGG - Intergenic
925219482 2:2126452-2126474 TCTGGGGCCCAGAAAGAAGAGGG + Intronic
925260922 2:2527825-2527847 ACTGAGGCCCCGAAAGTTAAGGG - Intergenic
925633531 2:5919196-5919218 TATGAGACCCAGAAAGAGAAAGG + Intergenic
926825412 2:16901336-16901358 TCAGAGGGGCAGAATGATATGGG + Intergenic
927307518 2:21590540-21590562 TCTGAGGCCCAGAGAGAAAGGGG + Intergenic
927373540 2:22385820-22385842 TCTGAGGCCCATAAAGAGAATGG - Intergenic
927517995 2:23683085-23683107 GCAGAGGCTCAGAGAGACAAAGG + Intronic
927811416 2:26182537-26182559 CCAGAGGCCCAGAGAGGGAAAGG + Intronic
930658845 2:54033930-54033952 TCAGACATCCTGAAAGATAATGG + Intronic
930877999 2:56241482-56241504 TCAGAGGCCCAGAAAGATAATGG - Intronic
932459768 2:71874709-71874731 TCAGGGGCCAAGGAAGAAAAGGG + Intergenic
932739796 2:74282830-74282852 TCAGAGGCCCAGGAAGGGGAAGG - Intronic
932747055 2:74342571-74342593 ACAGAAGCCCACAAAGCTAAGGG + Intronic
932792036 2:74662238-74662260 CCAGAGGCCTAGAGAGACAAGGG - Intronic
933144032 2:78829087-78829109 TCAGAGGTTCACAAAGGTAAAGG + Intergenic
933646990 2:84821024-84821046 TCAGAGGCCCAGGACCATAAAGG + Intergenic
934773043 2:96920102-96920124 GGACAGGCCCAGAAAGAGAAGGG + Intronic
936029114 2:109057636-109057658 TCGGAGGCTCAGAAAGACCAAGG - Intergenic
936656443 2:114493489-114493511 ATAGAAACCCAGAAAGATAAGGG + Intronic
937545444 2:123011879-123011901 TAAGAGTCCTAGAAAGAGAAGGG + Intergenic
938395484 2:130944368-130944390 TCAGAGTTCCAGAAGGAGAAGGG - Intronic
938511450 2:131950554-131950576 CCAGAGGCCAGGAAAGATAGAGG - Intergenic
939431840 2:142119735-142119757 TGAGAGGCAAAGAAAGACAAAGG - Intronic
941126781 2:161593870-161593892 TCAGAGGAACAAAAAGAAAAAGG - Intronic
944535046 2:200700793-200700815 TCAGAGACCCCAAAAGAAAATGG - Intergenic
945459826 2:210093040-210093062 GCATAGGCCCTGAAAGAGAATGG + Intronic
946042124 2:216791636-216791658 ACTGAGGCCTAGAAAGGTAAAGG + Intergenic
946218094 2:218201889-218201911 TCTGAGAGCCAGAAAGAAAATGG + Intergenic
946464927 2:219903406-219903428 TCTGAGGCACAGAATGGTAAAGG + Intergenic
947262291 2:228237088-228237110 TCAGAGGCCTGGAAGGGTAATGG - Intergenic
947594235 2:231400674-231400696 TCAGATGCCCAGGAAGGAAAAGG + Exonic
947616538 2:231560976-231560998 TCAGTGGCTCACAATGATAAAGG - Intergenic
1168799630 20:635728-635750 ATAGAGGCACAGAAAGGTAAAGG - Intergenic
1170408717 20:16066075-16066097 TCAGAGGCCAAGACACTTAAAGG + Intergenic
1170492066 20:16887059-16887081 TCTGAGGCACAGAAGGAAAAGGG - Intergenic
1171402430 20:24883833-24883855 TCTGAGGAACAGAAAGAAAAAGG + Intergenic
1171424998 20:25043546-25043568 TCAGAGTCCCAGGAAGCTGAGGG - Intronic
1171427279 20:25057126-25057148 TCTGAGGCCGAGAACGAGAACGG + Intronic
1171984306 20:31648830-31648852 GGAGCGGCCCAGAAAGATCATGG + Intergenic
1172329452 20:34064885-34064907 TCTGAGGCCCAGCAAGTGAAAGG + Intronic
1172807649 20:37624142-37624164 ACCGAGGCCCAGAGAGGTAAAGG + Intergenic
1172830263 20:37827936-37827958 TTAGAGGCCCAGAGATATGAAGG - Intronic
1172891226 20:38266971-38266993 TCAGAGGCTCAGAAGGGTAGTGG + Intronic
1173345917 20:42199739-42199761 TCAGAGCCACAGAAACAGAAAGG - Intronic
1173555651 20:43963585-43963607 ACAGAGGCCCGGAAAGTTTAGGG - Intronic
1173569316 20:44066494-44066516 ACTGAGGCCCAGAAAGGGAAAGG + Intronic
1173595541 20:44256828-44256850 ACTGAGGCCCAGAAAGTTTAAGG + Intronic
1173944729 20:46941415-46941437 ACTGAGCCCCAGAAAGATGAAGG - Intronic
1175748257 20:61476836-61476858 TCAGTGGCCCAGACAGACCATGG - Intronic
1176282349 20:64321055-64321077 CCAGGGCCCAAGAAAGATAAAGG - Intergenic
1176782474 21:13214233-13214255 CCAGAGGCCAGGAAAGATAGAGG - Intergenic
1176847609 21:13888668-13888690 TCAGAGGCTCAGGAGGAGAAGGG - Intergenic
1177587758 21:23120226-23120248 TCAATGGCCCAGGAAAATAACGG - Intergenic
1177743709 21:25185139-25185161 TCAAAGGTTCAGAAAAATAAAGG + Intergenic
1177939219 21:27387893-27387915 TCAGTGACCAAGAAAAATAAAGG - Intergenic
1177980028 21:27901379-27901401 CCAGAGGCCAGGAAAGATAGAGG + Intergenic
1178221794 21:30668990-30669012 CCAGAGGCCTAGGAAGAAAAAGG + Intergenic
1178605345 21:34031503-34031525 TCTGAGGCTCAGATAGATTAAGG - Intergenic
1179397001 21:41049711-41049733 TCAGAGGCTCAGAAAGGAGAGGG - Intergenic
1179976333 21:44869734-44869756 TCAGAGGCGCAGAAAGTTGAAGG - Intronic
1180363817 22:11922234-11922256 TCAGAGGCTCAGGAACAGAAGGG + Intergenic
1180910538 22:19447184-19447206 TCAGAGGGCGTGAAAGACAAAGG - Intronic
1181620348 22:24086881-24086903 TCAGGGTCCCAGAGAGAGAATGG + Intronic
1182288421 22:29261022-29261044 GCAGAGGCTCAGAAAGGAAAAGG + Intronic
1183080778 22:35454650-35454672 TCAGAGGCTCAGAGAGGTCAAGG - Intergenic
1183359668 22:37376886-37376908 TCAGAGGCCCAGAGAGGGACAGG + Intronic
1184556100 22:45233905-45233927 TCAGAGGTCCAGAGGGACAAGGG + Intronic
1184797724 22:46741503-46741525 CCAGGGGCCCAGGAAGAGAAGGG - Intergenic
1184803170 22:46774740-46774762 TCGGGGGCCCAGAAATATCAGGG - Intronic
1184810068 22:46825260-46825282 TCAGACCCCCAGGAAGAAAAAGG - Intronic
1203246989 22_KI270733v1_random:80509-80531 TCAGAGGCTAAGAAAGACAGTGG + Intergenic
949287032 3:2418962-2418984 ACTGATGCCCAAAAAGATAAAGG + Intronic
950324817 3:12096929-12096951 TGAGAGTCCCAGAAGGAGAAAGG + Intronic
950582730 3:13873159-13873181 ACAGAGGCCCAGAGAGAGAATGG - Intronic
950609815 3:14118910-14118932 TCACAGGCACAGAAAGCAAAGGG + Intronic
952673386 3:35998247-35998269 TTAGAGTCCCACAAAAATAATGG - Intergenic
953056026 3:39387855-39387877 AGAGAGGCCAAGTAAGATAAGGG + Intronic
953125726 3:40090177-40090199 GATGAGGCCCAGAAAGATCAGGG - Intronic
953405555 3:42658028-42658050 CCAGAGGCCCAGAAAGTGACAGG + Intronic
953743289 3:45555047-45555069 ACAGAGGCACAGAAAGGTTAAGG - Intergenic
954241455 3:49297027-49297049 TCATAGGCCCAAAAATGTAAAGG + Intronic
954462449 3:50635046-50635068 ACAGAGGCCCAGAGAGGAAAAGG + Intronic
954710468 3:52502877-52502899 CCAGAGGCCCAGCAAGGTCAGGG + Intronic
956113921 3:65899496-65899518 TCAGAGGTGCTGACAGATAATGG + Intronic
956337514 3:68180653-68180675 TCAGTTGCCAAGAAAAATAAGGG - Intronic
956823078 3:72971509-72971531 ACTGAGGCCCAGCAAGGTAAGGG - Intronic
958568248 3:95844170-95844192 TCAGAGGCTCAGAAAGGAAGAGG + Intergenic
958862548 3:99462501-99462523 CCAGAGGCTGAGAAAGGTAATGG + Intergenic
959867080 3:111283267-111283289 ACAGAGGCTCAGAGAGGTAAAGG + Intergenic
960243009 3:115367341-115367363 CCAGAGGCCCGGAAAGAGAAGGG + Intergenic
960261548 3:115574050-115574072 GCAGAGGCCCAGAATGACAAAGG + Intergenic
960580463 3:119274021-119274043 CAATAGGCCCAGAAAGAGAAGGG - Intergenic
961155959 3:124679998-124680020 TCAGTGTTCCAGAAAAATAACGG + Intronic
962030270 3:131592298-131592320 ACTGAGGCACAGAAAGATGAAGG + Intronic
962695803 3:137945997-137946019 TCACAGGCCTAGAATGATCAGGG - Intergenic
962751936 3:138439999-138440021 TCAGAGGCCCAGAGAGGACAAGG - Intronic
963504055 3:146162214-146162236 TCAAAGGCCCAGAGTTATAACGG - Intronic
963549836 3:146705339-146705361 TCAAGGGCACAGATAGATAACGG + Intergenic
963976158 3:151482507-151482529 TCAGAGGGGCAAAAAAATAAAGG + Intergenic
964740407 3:159959554-159959576 TCAGAGCTCCAGCAAGAAAAGGG - Intergenic
965480728 3:169216094-169216116 TCAGAGGTCCAGAAAAATAAAGG - Intronic
967194054 3:187011411-187011433 TCTGAGGGTCAGAAAAATAAAGG - Intronic
967954885 3:194870474-194870496 CCAGATGCCCAGAATGAGAAGGG - Intergenic
968527921 4:1073766-1073788 TCAGAGGGCGATAAAGATGAGGG - Intronic
969528365 4:7715680-7715702 GCAGAGGCTCAGAAAGACCAGGG - Intronic
969603803 4:8191865-8191887 TCGGAGGCCGGGAAAGATGACGG + Intronic
969721913 4:8896686-8896708 ACAGAGGCCCAGAGAGGTTAGGG + Intergenic
969842692 4:9893944-9893966 TCAGAGGCCAAGAGTGATTATGG + Intronic
970403930 4:15744072-15744094 ACAGAGGCCCAGAAGGTGAAGGG - Intergenic
970447499 4:16136389-16136411 ACAGAGGCCCAGAGAGATCTAGG + Intergenic
971566208 4:28144810-28144832 TCAGAGAACCTGAAAGACAATGG + Intergenic
972241831 4:37201716-37201738 TCTAAGGCAGAGAAAGATAAGGG + Intergenic
973841877 4:54870534-54870556 TCAGAGGAACAGTCAGATAAAGG + Intergenic
974225170 4:59032691-59032713 CCAGAGGCTGAGAAAGATAGTGG - Intergenic
974831983 4:67200995-67201017 TGAGAGGCCAAGAAAGAGAGAGG - Intergenic
974975392 4:68885627-68885649 CCAGAGGCTGGGAAAGATAATGG + Intergenic
975326514 4:73064593-73064615 TCTGAGGCCCAGAGAGGTTAAGG + Intronic
975334631 4:73161749-73161771 ACAGAGACACAGAAAGAGAAGGG + Intronic
976096562 4:81514511-81514533 GCAGATGCCAAGAAAGATTATGG + Intronic
977753784 4:100641034-100641056 TCAGAGGCTGAGAAACATAGTGG + Intronic
977923788 4:102675259-102675281 TCAGAGACTGAGAGAGATAAAGG - Intronic
978575368 4:110184578-110184600 TCAGTGACTCAGAAAGACAATGG + Intronic
978579090 4:110214705-110214727 ACTGAGGCCCAGAAAGGTGAAGG - Intergenic
979137463 4:117127805-117127827 TCACAGGCCCAGAAGCCTAAAGG + Intergenic
979569783 4:122207377-122207399 TGAGAGTCTCACAAAGATAATGG - Intronic
980830638 4:138126682-138126704 TCAGATGCCTAGGAGGATAATGG + Intergenic
982649172 4:158065136-158065158 TTAGATGAGCAGAAAGATAATGG + Intergenic
984991574 4:185386479-185386501 TCAGAGGCCCAGAAAGTGGTGGG + Intronic
1202765480 4_GL000008v2_random:145503-145525 TCAGAGGCTCAGGAACAGAAGGG - Intergenic
987202391 5:15590581-15590603 TGAGAGGCCCAGAAGCAAAAGGG - Intronic
987270989 5:16308979-16309001 TCAGAGATCTAGAATGATAAAGG + Intergenic
987489957 5:18567527-18567549 TCAGAGGCCTAAAAAGGTATAGG - Intergenic
988009169 5:25461572-25461594 CCAGAGGCCCAGGAGGAAAAAGG + Intergenic
988029662 5:25747130-25747152 TCAGAGGCCAAGAAGGGTAGTGG + Intergenic
988502191 5:31792725-31792747 TTATAGGCCCAGATAAATAATGG - Intronic
988510932 5:31864151-31864173 TCAGAAGCCCAGCAAGGTTAGGG - Intronic
988807711 5:34755880-34755902 ACTGAGGCACAGAAAGATTATGG + Intronic
991211495 5:64110141-64110163 TCAGAAGAGCAGATAGATAAAGG + Intergenic
991427839 5:66509850-66509872 TCAGATACCAAGAAAGAAAAGGG - Intergenic
994420354 5:99523125-99523147 GCTGAGGCCCAGAAATATGAGGG + Intergenic
994420522 5:99523944-99523966 GCTGAGGCCCAGAAATATGAGGG + Intergenic
994486518 5:100390370-100390392 GCTGAGGCCCAGAAATATGAGGG - Intergenic
994486686 5:100391189-100391211 GCTGAGGCCCAGAAACATGAGGG - Intergenic
994486855 5:100392008-100392030 GCTGAGGCCCAGAAATATGAGGG - Intergenic
994541020 5:101097370-101097392 TCAGAGGCTCAGGAGGGTAATGG + Intergenic
994971960 5:106750925-106750947 TCAAAAGCCCAGAAATATCATGG - Intergenic
995255143 5:110037211-110037233 TCAGAGACCCAGAAGGAGTAAGG - Intergenic
995605459 5:113849721-113849743 TCAAATGCACAGAAAGACAAAGG - Intergenic
996821982 5:127639621-127639643 CCAGAGGCCAAGAAAGAGAGAGG - Intergenic
997001231 5:129764571-129764593 TCAGAGGGTCAGAAACACAACGG - Intronic
997018490 5:129966412-129966434 TCAAATGCTCAGAGAGATAACGG - Intronic
997782419 5:136673534-136673556 TAAGAGGCCCAGAAATGTAATGG - Intergenic
998933065 5:147202659-147202681 TCAGAGGCTGAGAAGGATAGTGG - Intergenic
999583745 5:153067778-153067800 TTGGAGGCCCAGACAGATAAGGG + Intergenic
999734929 5:154506005-154506027 ACAGAGGCCCAGAGAGGTGAAGG + Intergenic
1000261944 5:159596546-159596568 TCAGAGGCCAAGTGAGATCAAGG - Intergenic
1000947724 5:167441957-167441979 CCCGAGGCCCAGAAAGCTTAGGG - Intronic
1001282352 5:170395851-170395873 GCAGTGGCCCTGACAGATAATGG + Intronic
1001771714 5:174301844-174301866 TCAGATGCACAGAAAGACTAGGG - Intergenic
1001839137 5:174858675-174858697 TGGGAGTCCCAGAAAGAGAAAGG - Intergenic
1001956066 5:175848983-175849005 TCAGAGGCCCAGAGAGTGACTGG + Intronic
1002293875 5:178217894-178217916 TCTGAAGACCAGAAAGAAAAAGG + Intronic
1002572431 5:180149979-180150001 TGAGAGTCCCAGAAAAAGAAGGG - Intronic
1004478085 6:15992862-15992884 TCAGAAGCGCAGCAAGATACTGG + Intergenic
1004751558 6:18566709-18566731 GCAGAGGCTAAGATAGATAATGG - Intergenic
1005257309 6:24016701-24016723 TCAGAGGCACGGCAAGATCATGG - Intergenic
1006390918 6:33757983-33758005 ACAGAAGCCAAGAAAGAGAATGG + Intergenic
1006504216 6:34477504-34477526 CCAGGGGCACAGAAAGATGAGGG + Intronic
1008418448 6:51270062-51270084 TCAGGGGCCCAGACAGATGGAGG - Intergenic
1010296270 6:74200387-74200409 CCAGAGGCTGAGAAGGATAAAGG - Intergenic
1011264858 6:85505461-85505483 TCAGACACCCAGAAAGAATAAGG + Intergenic
1011844183 6:91542396-91542418 GTAGAGTCCCAGAAAGAAAAAGG + Intergenic
1012247197 6:96938919-96938941 GCAGGGGCCCAGGAAGCTAATGG + Intronic
1012260230 6:97080241-97080263 TCAGAAGGCCAGAAAGAGAAAGG + Intronic
1012918247 6:105194271-105194293 TCAGAGGCACAGAAACAAATGGG + Intergenic
1013373993 6:109496525-109496547 TCAGAGGTCAAGCAAGACAAGGG - Intronic
1013703092 6:112797437-112797459 TCTGAGGCCTTGAAAGATAGTGG - Intergenic
1013732183 6:113181402-113181424 TTCAAGGCCCAGAAAGAAAAGGG - Intergenic
1014687720 6:124523718-124523740 ACAAAGACCCAGAAAGCTAAAGG + Intronic
1015809793 6:137150408-137150430 TAAGAGGCCCCGAAATAAAATGG + Intronic
1016410275 6:143775497-143775519 TCTGAGGCCCAGAGAGATTAAGG + Intronic
1017029903 6:150211826-150211848 TCAGAGGCATAGGAAGAGAAAGG - Intronic
1017790174 6:157790836-157790858 ACAGAGAACCAGAAAGACAAAGG - Intronic
1018080569 6:160256242-160256264 TCAGAGGCCCTGAAGGCTGATGG + Intronic
1018560159 6:165093674-165093696 TCAGACCCCCACAAAGAAAATGG + Intergenic
1018751020 6:166806067-166806089 TCTGAGGAACAGAAAGAAAAAGG + Intronic
1019053274 6:169200968-169200990 TGAGAGGCCAAGAAAGAGACGGG + Intergenic
1020477699 7:8617643-8617665 TCAGAGGCTGGGAAAGATAGTGG + Intronic
1021174420 7:17434660-17434682 TCAGAGGCCCAAAATGAAAGGGG + Intergenic
1023155202 7:37243963-37243985 TCAGTGGCTTAGAAAGAAAACGG - Intronic
1023475279 7:40571048-40571070 ACTGAGGCCCAGAAAGAAAGTGG - Intronic
1023750665 7:43369097-43369119 TCATGGCTCCAGAAAGATAATGG + Intronic
1024932167 7:54675345-54675367 TCAGAGGCCAATAAATACAAAGG - Intergenic
1025603532 7:63022727-63022749 ACTGAGGCCCAGAAAGGTGAAGG - Intergenic
1026141240 7:67708744-67708766 TCAGAGGCACAGAGAGTTTATGG - Intergenic
1026286636 7:68969181-68969203 ACATAGTCCCAGAAAGATCAGGG - Intergenic
1026499830 7:70935013-70935035 TCAGGGGCCAGGAAAGATGAGGG - Intergenic
1026513928 7:71050344-71050366 TCAGAGGAACAAAAAGAAAAAGG + Intergenic
1026995080 7:74610471-74610493 TCTGAGGTTCAGAAAGATGAAGG + Intergenic
1028378506 7:90173455-90173477 GCAGAGGCACAGGAAGAAAAGGG + Intronic
1028905473 7:96149591-96149613 TCAGAGGCCACCACAGATAATGG - Intronic
1029109092 7:98203126-98203148 TCTGATGCTCAGAAAGAGAAGGG - Intronic
1029444072 7:100603231-100603253 CCAGACTCCCACAAAGATAAGGG - Intronic
1029528300 7:101108871-101108893 TCGGTGGCTCAGAAAGAGAAGGG + Intergenic
1029946848 7:104542054-104542076 TGAGAGGCCAAGTAAGATAAGGG + Intronic
1033833536 7:145282307-145282329 TCAGAGCTCCAGAAACTTAAAGG - Intergenic
1034075298 7:148225645-148225667 TCAGAGGCCCAGTGGGATCAGGG + Intronic
1034785958 7:153925790-153925812 ACAGAGGCTCAGAAAGATTAGGG - Intronic
1036597074 8:10223655-10223677 CCAGAAGCCCAGACAGATACTGG + Intronic
1037899496 8:22679164-22679186 TCAGAGTCCCAGGAAGCCAATGG + Intergenic
1039027984 8:33278950-33278972 TCAGAGGCTCAGTGAAATAAGGG - Intergenic
1039439492 8:37584813-37584835 ACCGAGGCACAGAAAGATGAAGG - Intergenic
1044352079 8:91178326-91178348 TAAGTGGCCCAGAAAGAGGAGGG - Intronic
1045686494 8:104718128-104718150 ACAGAGGCTCAGAGAGATTAAGG + Intronic
1046450422 8:114383331-114383353 ACTGAGGCCCAGAAAGAGGAAGG + Intergenic
1046467366 8:114623550-114623572 TGAGAGGCCAAGGGAGATAAAGG - Intergenic
1046681689 8:117177630-117177652 TTAATGGCCCAGAAAGATGAAGG + Intergenic
1047207802 8:122817548-122817570 TCAGAGGGCCAGGAAGAAAAAGG + Intronic
1047416187 8:124666652-124666674 TCTGAGGTCCAAAAAGATGAAGG + Intronic
1047520720 8:125593657-125593679 ACTGAGGCCCAGAGAGATGAAGG + Intergenic
1048098262 8:131318300-131318322 CCAGAGGCCAAGCAAAATAAAGG - Intergenic
1048338214 8:133518832-133518854 TCTGAGGCTCAGAGAGATTAAGG + Intronic
1048453782 8:134558417-134558439 ACAGAGGCTCAAAAAGGTAAAGG + Intronic
1048617493 8:136093496-136093518 TAAGAGCCCCAGAATGACAAGGG - Intergenic
1048854904 8:138678331-138678353 TCAGAGGCCCAGAGGGACCAGGG - Intronic
1050180067 9:2912645-2912667 TCAGAGACCCAGAAATATTGTGG - Intergenic
1051221998 9:14858619-14858641 TGAGAAGCCAAGAAATATAAGGG - Intronic
1051804522 9:20977169-20977191 ACAGAGAACCAGAAAGATGATGG - Intronic
1052679690 9:31673444-31673466 TCAGAGACCCAGCATGACAAAGG + Intergenic
1053307206 9:36993532-36993554 ACTGAGGCCCAGACAGAGAAAGG + Intronic
1053416996 9:37953112-37953134 CCAGAGGCCCAGAAGGAGAGTGG + Intronic
1057140828 9:92725915-92725937 TCAGAGGCCCAGAGAGCCACAGG - Intronic
1057804388 9:98210153-98210175 TACGAGGCTCAGAAAGGTAAAGG + Intronic
1059370376 9:113826225-113826247 TCAGAGTCCCAGAAAGAGAAGGG + Intergenic
1059622497 9:116022877-116022899 TCAGGACCCCAGAAACATAAAGG + Intergenic
1059966290 9:119617733-119617755 CCAGAGTCCAAGAGAGATAAAGG + Intergenic
1060086976 9:120712737-120712759 TCAGAGACCCAGCTAGACAAAGG + Intronic
1060416020 9:123431363-123431385 ACTGAGGCCCAGAAACATTAAGG + Intronic
1060865456 9:126991694-126991716 ACAGAGACACAGAAAGATGAGGG - Intronic
1060906620 9:127312993-127313015 TCAGAGGCCCAGTAATGTCAAGG + Intronic
1060943857 9:127558436-127558458 ACTGAGGCCCAGGAAGATGATGG - Intronic
1060965285 9:127709018-127709040 ACTGAGGCTCAGAAGGATAAAGG - Intronic
1060969708 9:127731090-127731112 GCAGAGGCCCAGAAAGGTCAAGG + Exonic
1061238341 9:129354711-129354733 ACTGAGGCCCAGAGAGGTAAAGG - Intergenic
1062466545 9:136684101-136684123 TCAGGGTCCCAGACAGAAAAGGG - Intronic
1203463322 Un_GL000220v1:63570-63592 TCAGAGGCTAAGAAAGACAGTGG + Intergenic
1203546225 Un_KI270743v1:130393-130415 TCAGAGGCTCAGGAACAGAAGGG - Intergenic
1185535622 X:859329-859351 TCAGAGGCTGAGAAAGATAGTGG - Intergenic
1186366690 X:8902472-8902494 TCAGAAGCCCAAAAACATATTGG + Intergenic
1186792424 X:13011940-13011962 TCTGAGGCTCAGAAAGATGAAGG - Intergenic
1188523474 X:31063533-31063555 TGAGAGGCCCAGAGACAGAAGGG + Intergenic
1189746070 X:44170276-44170298 TCAGTGGCCCAGGAAGCTACGGG - Intronic
1189835282 X:45014455-45014477 AAAGATGCCCAGAAGGATAAAGG + Intronic
1189906259 X:45763112-45763134 ACAGAGGCACAGAGAGGTAAAGG - Intergenic
1190129798 X:47736730-47736752 TCAGAAGCCCAGATACAAAATGG - Intergenic
1190526925 X:51337634-51337656 TCAAATGCCCAAAAAGAGAAGGG + Intergenic
1190744138 X:53311240-53311262 ACTGAGGCCCAGAGAGAGAAAGG - Intronic
1190894605 X:54604789-54604811 ACTGAGGCACAGAAAGATTAAGG - Intergenic
1192226755 X:69233983-69234005 ACTGAGGCCCAGAAAGGGAAAGG - Intergenic
1192498901 X:71635731-71635753 ACAGAGGCCTAGGAAGAAAAGGG + Intergenic
1192576626 X:72247863-72247885 TCAGAGGCCCAGACTGGTCAAGG - Intronic
1193039440 X:76988877-76988899 TCAGAGTACCAGAAAGAGATGGG + Intergenic
1193058304 X:77177650-77177672 TCAGAGGCCCATAAAGGAATTGG - Intergenic
1194029764 X:88798025-88798047 TCAGAGGCTCAGCCAAATAATGG - Intergenic
1194363284 X:92981895-92981917 CCAGAGGCTGAGAAAGATAGAGG + Intergenic
1195029789 X:100915155-100915177 CCAGAGGTCCAGAGAGATGACGG + Intronic
1196224442 X:113149051-113149073 TCAGTGGACCAGAAATAGAATGG + Intergenic
1196655619 X:118214355-118214377 TCAGAGGCACAGATAGAAAATGG - Intergenic
1198769052 X:140109019-140109041 TCAGAGGCCCAGATAGGGGAAGG + Intergenic
1198885684 X:141333561-141333583 TCACATGGCCAGAATGATAAAGG - Intergenic
1199108447 X:143900894-143900916 TCAGAGGCTAAGAAGGATAGTGG + Intergenic
1200412443 Y:2874610-2874632 TCAGAGGCCAAAAAAAAAAAAGG + Intronic
1200671525 Y:6098144-6098166 CCAGAGGCTGAGAAAGATAGAGG + Intergenic
1201338339 Y:12904350-12904372 TCTGAAGCCAAGATAGATAAGGG - Exonic