ID: 930878413

View in Genome Browser
Species Human (GRCh38)
Location 2:56245391-56245413
Sequence GAGGCCATGTGGCATGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 1, 2: 2, 3: 30, 4: 337}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930878413_930878425 -2 Left 930878413 2:56245391-56245413 CCCTCCTCATGCCACATGGCCTC 0: 1
1: 1
2: 2
3: 30
4: 337
Right 930878425 2:56245412-56245434 TCTGCCAGGGGATGGAGGAGGGG 0: 1
1: 10
2: 42
3: 200
4: 1038
930878413_930878426 -1 Left 930878413 2:56245391-56245413 CCCTCCTCATGCCACATGGCCTC 0: 1
1: 1
2: 2
3: 30
4: 337
Right 930878426 2:56245413-56245435 CTGCCAGGGGATGGAGGAGGGGG 0: 1
1: 4
2: 43
3: 306
4: 1507
930878413_930878421 -7 Left 930878413 2:56245391-56245413 CCCTCCTCATGCCACATGGCCTC 0: 1
1: 1
2: 2
3: 30
4: 337
Right 930878421 2:56245407-56245429 TGGCCTCTGCCAGGGGATGGAGG 0: 2
1: 10
2: 30
3: 117
4: 683
930878413_930878424 -3 Left 930878413 2:56245391-56245413 CCCTCCTCATGCCACATGGCCTC 0: 1
1: 1
2: 2
3: 30
4: 337
Right 930878424 2:56245411-56245433 CTCTGCCAGGGGATGGAGGAGGG 0: 1
1: 9
2: 26
3: 149
4: 964
930878413_930878423 -4 Left 930878413 2:56245391-56245413 CCCTCCTCATGCCACATGGCCTC 0: 1
1: 1
2: 2
3: 30
4: 337
Right 930878423 2:56245410-56245432 CCTCTGCCAGGGGATGGAGGAGG 0: 1
1: 10
2: 17
3: 119
4: 634
930878413_930878428 2 Left 930878413 2:56245391-56245413 CCCTCCTCATGCCACATGGCCTC 0: 1
1: 1
2: 2
3: 30
4: 337
Right 930878428 2:56245416-56245438 CCAGGGGATGGAGGAGGGGGTGG 0: 1
1: 1
2: 25
3: 338
4: 2359
930878413_930878420 -10 Left 930878413 2:56245391-56245413 CCCTCCTCATGCCACATGGCCTC 0: 1
1: 1
2: 2
3: 30
4: 337
Right 930878420 2:56245404-56245426 ACATGGCCTCTGCCAGGGGATGG 0: 2
1: 5
2: 14
3: 70
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930878413 Original CRISPR GAGGCCATGTGGCATGAGGA GGG (reversed) Intronic
900627528 1:3615790-3615812 GAGGCCAGGTGGGATAAAGAGGG - Intergenic
900844297 1:5084029-5084051 GGGACCATGTGGAATCAGGAAGG - Intergenic
900959476 1:5909939-5909961 GTGTCCATGTGGCCTGGGGAGGG - Intronic
903173786 1:21569062-21569084 GAGGCCTCGTGGGATGAGGCTGG + Intronic
904804605 1:33121881-33121903 GAGGCAATGTGGCATGGGTTTGG + Intergenic
905747746 1:40433753-40433775 GAGGCCATGTATCCTGAGGAAGG + Intergenic
906107649 1:43304535-43304557 GAAGCCATCTGGCAGGAGAAGGG + Intronic
906568849 1:46819512-46819534 GTGGCCAAGTGGCATTAGAAGGG + Intergenic
906637648 1:47419875-47419897 GAGGCTCTGAGGCAGGAGGAGGG - Intergenic
907338577 1:53717116-53717138 TGGGCCATCTGGCATCAGGACGG - Intronic
907479704 1:54736992-54737014 GAGGCCATGTGGGGTGAAAAGGG - Intronic
907973512 1:59408081-59408103 GAGGCCATGTGGTGTCATGATGG + Intronic
914847965 1:151293238-151293260 GAGGGCATGTGGGCAGAGGAAGG + Intronic
915109254 1:153552705-153552727 GAGGGCAGGTGGCAAGAGGAAGG - Intergenic
917047632 1:170879778-170879800 GAGGCAATGTGGGATGAGAAAGG - Intergenic
917454090 1:175170839-175170861 GAAGCCATGAGGCGTGAGCAGGG - Intronic
917927858 1:179803948-179803970 CAGGCCAGGGGGCAGGAGGAGGG - Intronic
917927875 1:179803979-179804001 CAGGCCAGGCGGCAGGAGGAGGG + Intronic
917953289 1:180064057-180064079 GAGCCCAGGTGGAATGAGAAGGG - Intronic
918430284 1:184452539-184452561 GAGGCAAAGTGGCAAGAAGAGGG + Intronic
920051584 1:203167752-203167774 GAGGCGCTGTGTCACGAGGAGGG - Intergenic
920098096 1:203499706-203499728 GAGGGCATGTAGCAGGCGGAAGG - Exonic
920212123 1:204335795-204335817 GTGTCCATGTGGCATGGGCAGGG + Intronic
921282631 1:213582430-213582452 GAGGCCATGTGCCGTCAGTAAGG - Intergenic
922214338 1:223508394-223508416 GAGGCCAGGTGACAGGAGGGAGG - Intergenic
923383393 1:233443639-233443661 GAGGTCATCTGTCATGAGCATGG - Intergenic
924202755 1:241676820-241676842 GAGGCCATGAGGTGGGAGGATGG - Intronic
924557447 1:245130038-245130060 GAGTCCCTGTGGCATGATGAGGG + Intergenic
924852169 1:247841477-247841499 GAGCCCACGATGCATGAGGAAGG + Exonic
1062906618 10:1183852-1183874 GAGGCCAGGAGGGAAGAGGATGG + Intronic
1063055041 10:2495586-2495608 GAGCCCATGTGGCATGGAGCTGG - Intergenic
1067089278 10:43258415-43258437 GAGGGCAGGTGGCATGGGGCAGG - Intronic
1067157188 10:43792160-43792182 AAGGACAAGTGGCATAAGGAGGG - Intergenic
1068551013 10:58408102-58408124 GAGGCCCTGTGGCAAAAGGAAGG - Intergenic
1069164940 10:65143276-65143298 AATGCTATGTGGCATGAGAAAGG + Intergenic
1069375772 10:67790948-67790970 GAGGCCAGGTGGGAGGAGAAAGG + Intergenic
1069963159 10:72090656-72090678 GAGGCCAAGAGGCAGGAGGATGG + Intergenic
1071256794 10:83878615-83878637 GAGGCCAGGGGGCCAGAGGAAGG - Intergenic
1071290410 10:84184973-84184995 GAGGCCCTGTGGGGTGAGGTTGG - Exonic
1071531210 10:86391525-86391547 GAGGTCAGGTGGCAAGAGAAGGG + Intergenic
1073115577 10:101089808-101089830 GAGGCCATGGGGCCTGGGGAGGG - Exonic
1073323540 10:102629716-102629738 GAGGCCCTGGGGCTGGAGGATGG - Intronic
1073337176 10:102718515-102718537 GAGGCCAGGTGGCAGGGAGAGGG + Intronic
1074442792 10:113493645-113493667 GAGGCCACATGGCATGAGGAGGG + Intergenic
1075471373 10:122692676-122692698 GATGGCATGTGGAAGGAGGAAGG + Intergenic
1075809614 10:125215487-125215509 GCTGCAATGTGGAATGAGGATGG + Intergenic
1076512956 10:131025308-131025330 GAGGACATGGGCCAGGAGGAAGG + Intergenic
1076675682 10:132146431-132146453 CAGGTGATGTGGCATGAGGCAGG + Intronic
1076857240 10:133123447-133123469 GTGTGGATGTGGCATGAGGACGG - Intronic
1077023065 11:428242-428264 GAGGCCCTGGGGCAGCAGGAAGG + Intronic
1077412991 11:2412098-2412120 GAGGCCGTGTGGCCTCAGGGCGG - Intronic
1078927844 11:15890437-15890459 GCTGCCAGGTGGCCTGAGGAAGG - Intergenic
1079004069 11:16780269-16780291 GAGGCAGTGTGGGATGAGGAGGG - Intronic
1081561970 11:44226104-44226126 AAGGCCAGGTGCCATGAAGATGG - Intronic
1083411917 11:62499733-62499755 GAGGCCACGTAGAATGATGATGG + Intronic
1083882471 11:65555357-65555379 GAGGCCAGGAGGCAGGAGGCAGG - Intronic
1084237310 11:67796494-67796516 GGGGCCTTGTGGCAGGAGGAGGG - Intergenic
1085448205 11:76615246-76615268 GAGGCCATGTGGCATGGGCGCGG - Intergenic
1086090225 11:82997892-82997914 GAGGCCCTGTAGCATCAGCATGG - Intronic
1088545822 11:110957660-110957682 AAGGCAATGTGCGATGAGGAGGG + Intergenic
1089085628 11:115814822-115814844 GAGACCATGTGGAGGGAGGAGGG - Intergenic
1089198250 11:116707835-116707857 GAGACGAGGTGGCCTGAGGATGG + Intergenic
1090175862 11:124648911-124648933 GAAGCCCTGTGGGAGGAGGATGG - Intronic
1090211337 11:124922912-124922934 GAGGCCTTGTGACAGGAAGATGG + Intronic
1091160143 11:133412401-133412423 GAGAGCATGTGGCATGGGCACGG + Intronic
1092193633 12:6536460-6536482 GAGGCAAGAAGGCATGAGGAGGG - Intronic
1093024480 12:14233608-14233630 GAGGCCATGTGGTAACAGGCGGG - Intergenic
1093462831 12:19421772-19421794 GAAGCTATTTAGCATGAGGAGGG + Intronic
1094437036 12:30431997-30432019 GAGGCCATGTTGTATGAAGAAGG - Intergenic
1095646941 12:44558608-44558630 GAGGGACTGTGCCATGAGGAAGG + Intronic
1100818510 12:98408895-98408917 GAGGCCCTGTGGTAAGAGGAAGG + Intergenic
1100818521 12:98408976-98408998 GAGGCCCTGTAGTAGGAGGAAGG + Intergenic
1102698004 12:114815161-114815183 GAGGCCATGTGACAGGTGGCAGG - Intergenic
1103958689 12:124593900-124593922 GTGGCCATTTTGGATGAGGAGGG + Intergenic
1106140309 13:27006125-27006147 GAGGTCATGAGACAAGAGGAGGG + Intergenic
1106568649 13:30907388-30907410 GGGGCCATGTGGGCTGTGGAAGG + Intronic
1108490945 13:50981106-50981128 CAGGCAATGTGGCATTAGGAAGG + Intergenic
1110015742 13:70399515-70399537 TAGACAATGTGGCATGAAGAGGG + Intergenic
1110221569 13:73079802-73079824 AATGTCATGTGGCATGTGGATGG + Intergenic
1111949410 13:94698908-94698930 GAGGCAGTGAGGCAGGAGGATGG - Intergenic
1112606197 13:100909281-100909303 GAGGCCAAGTGAGATGAGAATGG - Intergenic
1112765437 13:102736886-102736908 GATTCCATGTGCCATGAGGGTGG + Exonic
1113693840 13:112330372-112330394 GGGGCCTCGTGGCATGTGGAGGG - Intergenic
1115323422 14:32110545-32110567 GAAACCATGTGACTTGAGGAAGG + Intronic
1115721151 14:36162435-36162457 GAGGGACTGTGCCATGAGGAAGG - Intergenic
1117790106 14:59331367-59331389 GAGGCCCTGGGGGAGGAGGAGGG - Exonic
1118603486 14:67486799-67486821 GAGGCCATGTGGCCATAAGACGG + Intronic
1118908689 14:70043270-70043292 GAGGCCAGGTGGCTTGGGGGAGG + Intergenic
1119266644 14:73266656-73266678 GAGGTCAGGTGGCATGGGTAGGG + Intronic
1121326541 14:93023439-93023461 GTGGACATGTGGCATGAGTGCGG + Intronic
1121791323 14:96701765-96701787 TAGGCCATGTGGCCAGGGGAGGG + Intergenic
1122194803 14:100076887-100076909 GACCCCATGTGGCATGAGGAAGG - Intronic
1122504114 14:102220871-102220893 GAGGCTGTGTGGCAGGAGGATGG - Intronic
1122635571 14:103128117-103128139 CAGGCCAGGAGGCAGGAGGAGGG + Intronic
1122637263 14:103136009-103136031 GAGGCCTTGGGGGATGAAGAGGG - Exonic
1122718512 14:103709105-103709127 GAGGACATGTGCCCTGGGGAGGG + Intronic
1122810815 14:104287012-104287034 GAGGCCACTTGGACTGAGGAAGG + Intergenic
1122956834 14:105075117-105075139 GAGGCCCAGGGCCATGAGGAGGG - Intergenic
1124670516 15:31634591-31634613 GAGGCCTTGAGGGATAAGGAGGG - Intronic
1126090565 15:45047725-45047747 GAAGCCATGTGGCAGGAGCCAGG - Intronic
1126555565 15:49983862-49983884 AAGGCCCTGTGGCAGGAGTAAGG - Intronic
1126921429 15:53529942-53529964 GAGGAAATGTAGCAGGAGGAAGG - Intronic
1127643836 15:60940488-60940510 GAGGCCAGGTTGCAGGGGGACGG + Intronic
1128532381 15:68463336-68463358 GAGGAGATGAGGGATGAGGAAGG + Intergenic
1128761196 15:70217093-70217115 GAGGCCATGTAGCAAGTGAAGGG - Intergenic
1129167900 15:73789281-73789303 GATGCCAGGTGGGAGGAGGATGG + Intergenic
1129412956 15:75359902-75359924 GAAGCCATGTGCCATTATGAAGG - Exonic
1130089099 15:80804463-80804485 GTGGCCATGTGACCGGAGGAAGG + Intronic
1130094111 15:80843601-80843623 CAGGCCAGGTGGCAGAAGGAAGG + Intronic
1130517635 15:84638316-84638338 GAGGCCATGTGTTTTGAGAAGGG + Intergenic
1132482098 16:171905-171927 GAGGGGATGTGGGGTGAGGAAGG - Intergenic
1132599195 16:766507-766529 GGGGTCATGTGGCATGAGATTGG + Intronic
1132861006 16:2071823-2071845 GAGGCCCTGTGGGAGGAGAAAGG - Exonic
1132934410 16:2473614-2473636 GAGGACCTGAGGGATGAGGATGG - Intronic
1133101504 16:3482800-3482822 GGGGGCATGTGGAAAGAGGATGG - Intronic
1134008933 16:10836823-10836845 TAGGGCATGGGGCATGGGGATGG + Intergenic
1134390988 16:13819839-13819861 AAGGCCATGAGGGATGAGGCTGG - Intergenic
1136061103 16:27726989-27727011 GAGACCATGTGGCCTGGGGCAGG + Intronic
1137585849 16:49663818-49663840 GGGGCCCTGCGGCATGGGGATGG - Intronic
1137758416 16:50920594-50920616 GAGGCCGTGTGGCAGCAGGTGGG - Intergenic
1139672460 16:68501043-68501065 GACCCCAAGAGGCATGAGGATGG - Intergenic
1141385700 16:83620622-83620644 GAGAGCATGTGGCGTGTGGAAGG - Intronic
1141948916 16:87328284-87328306 CAGGGCATGTGGCTAGAGGAAGG + Exonic
1142614522 17:1126723-1126745 GGGGCCAGGTGCCATGGGGAGGG - Intronic
1142742840 17:1940970-1940992 GAGGCCTTGCGGCAGGGGGACGG + Intronic
1142985882 17:3695254-3695276 CCTGCCAGGTGGCATGAGGATGG + Intronic
1143526827 17:7478006-7478028 GAGGGGATTTGGTATGAGGAAGG - Intronic
1144948601 17:18982292-18982314 CAGGCCATGAGGCAAGAGGTGGG - Intronic
1145006137 17:19339041-19339063 GAGGCCATCTGGGATCATGATGG + Intronic
1145899991 17:28484398-28484420 GAGGCCCTGTGGCCAGAGGGAGG + Intronic
1147134261 17:38426062-38426084 GAGGCCATGGGGGAGGAGGGAGG - Intergenic
1147136169 17:38435284-38435306 GATGCCAAGTGGGAGGAGGAAGG + Intronic
1147318467 17:39632263-39632285 GAGCCCAGGAGGCATGAGGGAGG + Intronic
1150196500 17:63304806-63304828 GAGGCCCCGTGCAATGAGGAGGG + Intronic
1150483341 17:65527513-65527535 GAGGGCATCTGGCAAGAGGCTGG - Intergenic
1152063667 17:78097972-78097994 GAGGCCGTGTGGCGTGATGAAGG + Intronic
1156215519 18:34994175-34994197 GAAACCATGTGGGATGGGGAGGG + Intronic
1157016309 18:43719499-43719521 GAGGCCCTGCCCCATGAGGAGGG - Intergenic
1158396737 18:57084942-57084964 GAGTAAATGAGGCATGAGGATGG + Intergenic
1158453977 18:57590757-57590779 GAGGCCACATGGCTTGAGTAGGG + Intergenic
1158850927 18:61495508-61495530 GAGCCCAGGAGGCAGGAGGAGGG + Intronic
1160428216 18:78792879-78792901 GACGGCGGGTGGCATGAGGACGG + Intergenic
1161509636 19:4663297-4663319 GAGGCTGTGTAGAATGAGGATGG - Intronic
1161509654 19:4663384-4663406 GAGGCTGTGTAGAATGAGGATGG - Intronic
1161509665 19:4663431-4663453 GAGGCTGTGTAGAATGAGGATGG - Intronic
1161509686 19:4663517-4663539 GAGGCTGTGTAGAATGAGGATGG - Intronic
1161509743 19:4663736-4663758 GAGGCTTTGTAGAATGAGGATGG - Intronic
1161509756 19:4663781-4663803 GAGGCTGTGTAGAATGAGGATGG - Intronic
1161688674 19:5717998-5718020 GAGGCCATGTGGGCTGGGCACGG - Intronic
1161833194 19:6625205-6625227 GAGCCCATGTGTCAGGAGTAAGG - Intergenic
1162178691 19:8851414-8851436 GACCCTATGTGGCCTGAGGATGG + Intronic
1163001705 19:14372347-14372369 GAGGCCCAGAGGCATGCGGAGGG + Intergenic
1163064620 19:14784012-14784034 GAGGCCCAGAGGCATGCGGAGGG - Intergenic
1163446787 19:17351680-17351702 GAGGCCAGGAGGCTGGAGGAGGG + Exonic
1163726183 19:18924396-18924418 GAGACCAGGTGGCAGGAAGAAGG - Intronic
1165829449 19:38723278-38723300 CAGGCCTTGGGGCCTGAGGAGGG - Intronic
1165899394 19:39161762-39161784 GAGGCCACGTGGCTGGAGCAGGG - Intronic
1166766094 19:45252551-45252573 GAGGCCCTGGGGCAGGAGAAAGG - Intronic
1167610651 19:50506384-50506406 GAGGCCCTGGGGGATGAGGACGG - Exonic
1168539561 19:57198854-57198876 GAGGCCAGGTCCCTTGAGGAAGG - Intronic
925297332 2:2786213-2786235 GAAGCAATGAGGCATCAGGAAGG + Intergenic
925452217 2:3979358-3979380 GAGGCAATGGGACATGAGGGTGG + Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
927648955 2:24899240-24899262 GAGGCGGTGTGCCAGGAGGAGGG - Intronic
930878413 2:56245391-56245413 GAGGCCATGTGGCATGAGGAGGG - Intronic
931317627 2:61147472-61147494 GAGGACATGCAGCAAGAGGAAGG - Intronic
931838324 2:66123831-66123853 GAGGGGATGAGGAATGAGGAGGG - Intergenic
933289323 2:80420364-80420386 GAGCCCAGGAGGGATGAGGATGG + Intronic
934158763 2:89228248-89228270 GAGGCCATGAGGCCTCAGTAAGG - Intergenic
934208512 2:89954180-89954202 GAGGCCATGAGGCCTCAGTAAGG + Intergenic
934767048 2:96885498-96885520 GAGGCCATGGCGCATGGGGCTGG + Intronic
934780498 2:96966729-96966751 GAGGTGATGAGGCATGAGGGTGG + Intronic
935171276 2:100612917-100612939 GAGGCCATGGGGCATGAGGAGGG - Intergenic
936379554 2:111972338-111972360 GAGGACATGAAACATGAGGATGG + Intronic
937111692 2:119371549-119371571 GAGTACATGGGGCCTGAGGATGG - Intronic
938258610 2:129879691-129879713 GAGGCCTTGTATCAAGAGGAGGG + Intergenic
938742593 2:134246740-134246762 GAGGCCATGTAGTATTAGGCAGG + Intronic
939458685 2:142470421-142470443 GAGCCCAAATGGGATGAGGAGGG + Intergenic
940212199 2:151266389-151266411 ATGGCCATGTAGCTTGAGGAAGG + Intergenic
940890472 2:159030893-159030915 GAGTCCAGGTGTCAGGAGGAAGG + Intronic
941909321 2:170747822-170747844 GAGCACATGTGGTATGAGGGAGG + Intergenic
942671034 2:178376708-178376730 GAAGACAGGTGGCATGAGGCTGG - Intronic
943950639 2:194129475-194129497 AAGGCCATGTGGGAGGAGAAAGG - Intergenic
944366664 2:198928951-198928973 GAGCCCATGAGGCAGGAGGGTGG - Intergenic
944529533 2:200653588-200653610 GAGGCCCTGTGGGACGATGAAGG - Intronic
945459634 2:210090587-210090609 GAGGGCAAGTGGCATGATCATGG + Intronic
947918037 2:233847312-233847334 AAGCCCATGTGGCCTGAGGCGGG - Intronic
948183435 2:236000912-236000934 GATGCCGCGTGGCGTGAGGAGGG + Intronic
948891679 2:240909897-240909919 GAGACCATAGGGCCTGAGGAAGG + Intergenic
1169104793 20:2985608-2985630 CAGGCCCTGTGGAATGAGGTGGG + Intronic
1169366558 20:4997358-4997380 AAGGCCCTGAGGCAGGAGGAGGG - Intronic
1169542597 20:6616634-6616656 GAAACCATGTGGAATGAGAAAGG - Intergenic
1171358211 20:24566983-24567005 CAGGCCATGTGGCTAGAGAAGGG - Intronic
1171480929 20:25455136-25455158 GAGGCCAGGTGGCATTTGGAAGG - Intronic
1172055627 20:32152431-32152453 GAAGGAATGAGGCATGAGGAAGG - Intronic
1172387905 20:34546973-34546995 AAGTCCATGGGGCGTGAGGAGGG + Intronic
1173931915 20:46827831-46827853 GAGGCCATGTACCCTGAGGTGGG - Intergenic
1174157926 20:48528641-48528663 GAGGCCATGTGACCAGAGCAAGG + Intergenic
1174482168 20:50838945-50838967 GAGGCCCTGTGGGGTGAGGCTGG + Intronic
1175618915 20:60426902-60426924 GAGCCCATGTCTTATGAGGAAGG + Intergenic
1175915093 20:62422534-62422556 GAGGCCATGGGGCCTGGGGTGGG + Intronic
1175999869 20:62826951-62826973 GAGGGCTTGTGGCATGGGTACGG + Intronic
1176885170 21:14246554-14246576 CAGGCCAAGTTGTATGAGGAGGG - Intergenic
1177136319 21:17308534-17308556 GAGGGACTGTGCCATGAGGAAGG + Intergenic
1177695643 21:24567037-24567059 GAGACCATGTGCAATGAGAAAGG + Intergenic
1178998214 21:37427160-37427182 AATGCCATGTGGCATAAGCATGG + Intronic
1179164925 21:38927831-38927853 GAGGCCATAGCCCATGAGGAAGG - Intergenic
1179564728 21:42240106-42240128 GAGGGCAGGTGGCAGGATGAGGG + Intronic
1180974707 22:19841975-19841997 AAGGCCATGAGGCCTGAGGCAGG + Intronic
1181035740 22:20168995-20169017 GAGGCTTTGTGGGATGAGGGTGG + Intergenic
1181698217 22:24604660-24604682 GAAGCCATGTCACCTGAGGAAGG - Intronic
1183061939 22:35341558-35341580 GAGGCCAGGTGGCCTGAGAGGGG - Intronic
1183346865 22:37312884-37312906 GAGGCCTGGTGGCCAGAGGAAGG + Intronic
1183385880 22:37514363-37514385 AAAACCATGTGGCATGGGGAAGG - Intronic
1183771806 22:39933062-39933084 GAGACCATGGGGTATGAGGGGGG + Intronic
1183978372 22:41526078-41526100 GAGCCCATGTGGCCTTAGGGTGG + Exonic
1184172764 22:42769388-42769410 GAGACCCCGTGGCAGGAGGAAGG + Intergenic
949093110 3:52813-52835 GAGCCCATGTGCCCTGGGGAAGG - Intergenic
949515106 3:4800494-4800516 GATGCCATGGGGCTTGGGGAGGG - Exonic
950108100 3:10401071-10401093 GAGGTCACCTGGCAAGAGGAAGG + Exonic
950431663 3:12954432-12954454 GAGGCCCTGGGGCATGTGGATGG + Intronic
950441565 3:13013904-13013926 GAGGACATGAGGCCTCAGGATGG + Intronic
950684804 3:14608811-14608833 GAGGCCCTGCAGCCTGAGGAAGG - Intergenic
951066616 3:18274202-18274224 GAGACCCTGTGGTATAAGGACGG + Intronic
952541582 3:34372994-34373016 GAGGGGATGTGCCAAGAGGAGGG + Intergenic
953743323 3:45555302-45555324 GAGGCCAGGTGGCCTCAGGCAGG - Intergenic
954329665 3:49882926-49882948 AGGGACTTGTGGCATGAGGAAGG + Intergenic
954927693 3:54251289-54251311 GAGGCCATGTTGCTGGAGGTGGG + Intronic
955349584 3:58183813-58183835 GGGGAAATGTGGCAGGAGGAAGG + Intergenic
955881333 3:63549456-63549478 GAGGTCATGTGGCTAGAAGATGG - Intronic
956401163 3:68881670-68881692 GATGCCATGAGGCATGTGTAAGG - Intronic
956755494 3:72381948-72381970 CAGGCTATGTGGGATGAGGGCGG + Intronic
956802925 3:72779262-72779284 AAGGCTCTGTGGCAGGAGGAGGG - Intronic
956870069 3:73408117-73408139 GAGGTCATCTGGCTTGTGGAGGG - Intronic
957033370 3:75268892-75268914 GAGCCCATGTGCCCTGGGGAAGG - Intergenic
960722943 3:120642409-120642431 CTGGGCATGTGGAATGAGGAGGG + Intronic
961301573 3:125925281-125925303 GGGGGCTTGTGGCAGGAGGAGGG + Intergenic
961815627 3:129548705-129548727 GGGGGCATGGGGCATGAGGCAGG + Intronic
962640193 3:137377498-137377520 GAGGGACTGTGCCATGAGGAAGG - Intergenic
962953727 3:140245020-140245042 GAGGCTCTGTGGTATGAGGGAGG - Intronic
963045905 3:141102575-141102597 AAGGCCCTGTGGCAAGAGGGAGG + Intronic
963963701 3:151340889-151340911 CAGGAAATGTGGGATGAGGATGG + Intronic
964543544 3:157806878-157806900 GAGTCCATCTGGCAAGAAGAAGG + Intergenic
965624221 3:170671140-170671162 GAAGCAATGTGCCTTGAGGAAGG + Intronic
966461115 3:180177461-180177483 GAAGCCAGGTGGCAGGATGATGG - Intergenic
967132923 3:186489096-186489118 CTGGCTATGTGGGATGAGGAGGG - Intergenic
968103616 3:195985515-195985537 GAGGCCAAGTGGCTGGAGCACGG + Intergenic
968790588 4:2658510-2658532 GAGTCGATGTGGCACGTGGATGG - Intronic
968816310 4:2823581-2823603 GTGGCCAGGTGGCATGTGGGTGG + Intronic
968826328 4:2900398-2900420 GAGGTCATGTGGCGTTAGGACGG - Intronic
969337323 4:6519342-6519364 TAGTCCCTGTGGTATGAGGAGGG + Intronic
969500528 4:7549883-7549905 CAGGCCCTGTGGCATGGGGGTGG - Intronic
971647623 4:29229536-29229558 GAGGGACTGTGCCATGAGGAAGG + Intergenic
973676495 4:53268646-53268668 GAGCCCGAGAGGCATGAGGAGGG + Intronic
975193667 4:71496791-71496813 GAGGCCATGTAACATGGAGATGG + Intronic
976361948 4:84190118-84190140 GAGGAGATGGGGCTTGAGGAAGG + Intergenic
976474979 4:85473681-85473703 AAGGCCATGTGGGTTGATGAAGG + Intergenic
977169182 4:93739392-93739414 GAATCTATGTGGCATGATGAGGG - Intronic
982134405 4:152259503-152259525 AAGGCCCTGTGGCAGGGGGAGGG - Intergenic
984783973 4:183551761-183551783 GAGGCCAAGAGACCTGAGGAGGG + Intergenic
985118592 4:186616492-186616514 GAGGGCATGTGGCTCGAGCAGGG - Intronic
985498405 5:224611-224633 GAGGCCATGTGGCTGGAGCAGGG - Intronic
985678704 5:1245113-1245135 CTGCCCATGTGGCATGGGGACGG + Intronic
985999231 5:3617136-3617158 GATGCCAAGTGGCTTAAGGATGG + Intergenic
986171569 5:5318691-5318713 GAGATAATGTGGCTTGAGGAAGG + Intronic
986376006 5:7131591-7131613 GAGGCCAGGTGGCCTGAAAAGGG - Intergenic
986668911 5:10126513-10126535 GAGGCCATGCTGGATTAGGATGG - Intergenic
986802720 5:11278621-11278643 GAGGGGATGTGGCTTGAAGATGG + Intronic
987914157 5:24189717-24189739 GAGGGCAAGTGGCATGATTATGG - Intergenic
991321810 5:65382646-65382668 TATGCCCTGTGGCAGGAGGAAGG - Intronic
991977944 5:72201013-72201035 GAGGCCATGGGGTAAGAGAAGGG - Intronic
992178914 5:74177794-74177816 GAGGCCCTGTGGCAGGAGCCTGG - Intergenic
992397208 5:76379059-76379081 GAGGGCATGTGGCTGGAGCACGG + Intergenic
992768619 5:80026526-80026548 GAGCCCATGTGGCCTGCGAAGGG - Intronic
994167838 5:96626447-96626469 GAGGGCAGGAGGAATGAGGATGG - Intronic
994879836 5:105475853-105475875 CAGCCCATGTGGCTTGTGGATGG - Intergenic
995677891 5:114683996-114684018 GAGGCCATGTGACCTGTGCAAGG + Intergenic
996518725 5:124402247-124402269 GAGTCCCTGTGGCATGGGGCTGG - Intergenic
996785379 5:127231349-127231371 GAGGCCATGTGGCAACAGCAGGG - Intergenic
996824145 5:127662245-127662267 GAGGTCATATGGCATGACCATGG + Intergenic
999470489 5:151850449-151850471 AAGGCCATGTGGGAGGAGAATGG + Intronic
1001596368 5:172901371-172901393 GTGGCCAGGTTGCCTGAGGAGGG - Intronic
1002000144 5:176192728-176192750 AAGGCCATGAGGCCTGTGGAGGG - Intergenic
1002318529 5:178361431-178361453 GGGCACATGTGGCCTGAGGAGGG + Intronic
1002561142 5:180083133-180083155 GACCCCATGTGGCAGGAAGAAGG - Intergenic
1002660440 5:180787900-180787922 AAGGCCAAGAGGCTTGAGGAGGG + Intergenic
1003432672 6:6054331-6054353 GAGCCCATGTGGCAGCTGGAAGG + Intergenic
1003482029 6:6543237-6543259 GAGACCAAGTGGCAAGAGTAAGG - Intergenic
1003570663 6:7254314-7254336 GAGGGCATGGGGCATGGGGATGG + Intergenic
1005695769 6:28351340-28351362 GAGCCCAAGTGGAATGAGGAGGG - Intronic
1007782293 6:44261577-44261599 TAGGGCCTGTGGGATGAGGAGGG - Intronic
1008542580 6:52558100-52558122 GAGCCCACGTGGCCTGAGGTGGG - Intronic
1011465099 6:87647247-87647269 GAGGCCATGTGGGGAGAGGAGGG - Intronic
1011790497 6:90893551-90893573 GAGGCCTTGTGGCATGCGTGAGG + Intergenic
1011857516 6:91713188-91713210 GAAGGCAGGGGGCATGAGGACGG - Intergenic
1013318886 6:108967390-108967412 GGGGCCGTGTGGCATAAAGATGG + Intronic
1015706887 6:136097845-136097867 GAGGACTTGTGGCAGGAGGATGG - Intronic
1015785203 6:136916140-136916162 GAGGCTATGTGGCAGGACCATGG - Intergenic
1015880830 6:137868198-137868220 GAGGCCAGGTGGCAGGATGTGGG - Intronic
1018038848 6:159904257-159904279 GAGGCCGTGAGGCAAGACGAGGG - Intergenic
1019136455 6:169911630-169911652 CAGGCCAGGTGGCACGAGCAGGG + Intergenic
1019468233 7:1202205-1202227 GTGGCCATGTGGCATGGACAGGG + Intergenic
1019600929 7:1883427-1883449 GGGGCCATGAGTCATGGGGAGGG + Intronic
1021596172 7:22319387-22319409 AGGGCCATGTGGCCTGGGGAAGG - Intronic
1021898160 7:25257069-25257091 AAGCCCAAGTGTCATGAGGATGG + Intergenic
1022444407 7:30457950-30457972 TAGCCCATGTGGCATGAAGTGGG + Intronic
1022652138 7:32287320-32287342 GAGGCCCTGTGGCTGGAGGGAGG - Intronic
1022846970 7:34220099-34220121 GAGGCCAGGTCCCATAAGGAGGG - Intergenic
1023770262 7:43550594-43550616 GAGGCCCGGTGGCCTGGGGAAGG + Intronic
1024969115 7:55052613-55052635 GATGCCTGGTGGAATGAGGAAGG + Intronic
1028197635 7:87925991-87926013 GAAGCCATGTCACATGAGGCAGG + Intergenic
1031967121 7:128034485-128034507 GAGACCCTGTTGCCTGAGGAGGG - Intronic
1032709724 7:134451209-134451231 AAGGACATGAGGCAGGAGGATGG - Intronic
1033534071 7:142296117-142296139 GAGACCATGCAGCATGTGGAAGG + Intergenic
1033626805 7:143118221-143118243 GAGGCCATGAGGCTTGGGGAAGG - Intergenic
1034214494 7:149394684-149394706 GAGGCCATGTGGGAAGAGTGGGG - Intergenic
1034221429 7:149449419-149449441 GAGGCCATCTGTGATGAGGCAGG + Intronic
1034267608 7:149788831-149788853 GAGGCCCTGTGCCAAGAGAATGG + Intergenic
1034411704 7:150945546-150945568 GAGGCCATGGAGGAGGAGGAAGG + Intronic
1034889543 7:154827744-154827766 GAGCCCAAGTGGAGTGAGGAGGG + Intronic
1035784947 8:2252998-2253020 CATGCCATGGGGCATGGGGAGGG + Intergenic
1035807865 8:2468723-2468745 CATGCCATGGGGCATGAGGAGGG - Intergenic
1035909280 8:3548195-3548217 CAGCCCTTGTGGCTTGAGGAAGG - Intronic
1039437126 8:37567331-37567353 GAGGCCCTGGGGCCTGAGAAAGG - Intergenic
1040590313 8:48786796-48786818 GAGTGGGTGTGGCATGAGGAAGG + Intergenic
1041523466 8:58779756-58779778 GAGGCCAGGAGGCATGAAGGAGG - Intergenic
1042719272 8:71809398-71809420 GATGCGATGTGGCAGGAGAAAGG - Intergenic
1044749095 8:95399368-95399390 GAGGACAAGTGACTTGAGGAAGG + Intergenic
1044966501 8:97579115-97579137 GAGGCCAGGTGGGGTGAGGAGGG - Intergenic
1045150455 8:99401520-99401542 GTGGCCTTCTGACATGAGGAAGG + Intronic
1045912936 8:107431524-107431546 GAGGGCATGTGGCCTGTGCAAGG - Intronic
1048032570 8:130646458-130646480 GAGGAAATGAGGCATGAGGAAGG - Intergenic
1048948612 8:139474092-139474114 GACACCAGGTGGCATGAGGCAGG + Intergenic
1049252885 8:141598642-141598664 GAGGCCAAGGGGGAGGAGGAAGG - Intergenic
1049478113 8:142806262-142806284 GAGGCCTAGTGGCATGAGTCAGG - Intergenic
1049562201 8:143317449-143317471 CAGGCCATGGGGCCTGAGTAGGG + Intronic
1049769368 8:144372820-144372842 GGAGCCATGTGGGAGGAGGAGGG + Intergenic
1050589740 9:7149117-7149139 GAGGCCAAGGGGCCTGAGGGCGG - Intergenic
1051473158 9:17472947-17472969 GAATCCATGCTGCATGAGGAGGG - Intronic
1051817792 9:21130318-21130340 GAGGCCATGAGGGTGGAGGATGG - Intergenic
1052852368 9:33385901-33385923 GAGGTCCTGTGGCTTGGGGAGGG - Intronic
1053046023 9:34917949-34917971 AAGGCCATGTGGGAGGAGAATGG + Intergenic
1053680467 9:40482452-40482474 GAGGTCCTGTGGCTTGGGGAGGG - Intergenic
1053930456 9:43110763-43110785 GAGGTCCTGTGGCTTGGGGAGGG - Intergenic
1054283245 9:63142483-63142505 GAGGTCCTGTGGCTTGGGGAGGG + Intergenic
1054293552 9:63317967-63317989 GAGGTCCTGTGGCTTGGGGAGGG - Intergenic
1054391574 9:64622456-64622478 GAGGTCCTGTGGCTTGGGGAGGG - Intergenic
1054504154 9:65893872-65893894 GAGGTCCTGTGGCTTGGGGAGGG + Intronic
1054730809 9:68701249-68701271 AGGGCAATGTGGCAGGAGGATGG + Intergenic
1054797696 9:69317896-69317918 GAGGGCATGTGGTTTGATGAAGG - Intergenic
1056591769 9:87970355-87970377 GGGGCCAGGTGGGATGAGAATGG - Intronic
1057719093 9:97518007-97518029 GAGGCGATGGGGGATGAGAATGG - Intronic
1057909422 9:99006056-99006078 GAGGGTATGAGGCATGATGAGGG - Intronic
1059555607 9:115277172-115277194 GCGGCCATGTGGCATGGAAAGGG - Intronic
1060228642 9:121811461-121811483 GTGGCCATGTGGCCTGGGCAGGG + Intergenic
1060496076 9:124119418-124119440 GAGGCTACCTGGCATGGGGAGGG - Intergenic
1060626583 9:125118702-125118724 GAGGCCATGTGGGGTGGGGGTGG - Intronic
1062324477 9:136005550-136005572 GGGCCCATGTGGCAAGGGGATGG - Intergenic
1186643975 X:11486721-11486743 AAGCCCAAGTGGCATGAAGAGGG + Intronic
1189035859 X:37492908-37492930 GAGGGCATGTGGGATGGGGTGGG + Intronic
1189330427 X:40141421-40141443 CAGGCCAGATGGCTTGAGGAAGG + Intronic
1189370118 X:40421227-40421249 GAGGCCATGTGGAGGGAGAAAGG - Intergenic
1190045357 X:47107541-47107563 GAGTGCATGTGGCATGATCACGG + Intergenic
1190936479 X:55002885-55002907 GAAGCCATGTGGTATGGGGAAGG + Intronic
1191225706 X:58040662-58040684 GAGGCCATGCAGGATGGGGAAGG - Intergenic
1191849601 X:65576392-65576414 GAGGCAATGTGCTATGAGCAGGG - Intergenic
1192659879 X:73030792-73030814 CAGGCAAAGTGGCATGAGGGAGG - Intergenic
1194032196 X:88831346-88831368 GAGGCCAGGTCCCTTGAGGAAGG - Intergenic
1195013102 X:100752491-100752513 GAGCCCAAGTGGAATGAGAAGGG + Intergenic
1195289072 X:103414195-103414217 ATGGCGATGTGGCAGGAGGAGGG + Intergenic
1202199366 Y:22330866-22330888 GAGTCCATCTGGCTTAAGGAGGG + Intronic