ID: 930881555

View in Genome Browser
Species Human (GRCh38)
Location 2:56276434-56276456
Sequence GTGTCGTAGGAGGAACTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 5, 3: 58, 4: 314}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930881544_930881555 21 Left 930881544 2:56276390-56276412 CCCACCCAAATCTCATCTTGAAT 0: 7461
1: 10942
2: 10318
3: 7687
4: 6503
Right 930881555 2:56276434-56276456 GTGTCGTAGGAGGAACTGGTGGG 0: 1
1: 0
2: 5
3: 58
4: 314
930881547_930881555 16 Left 930881547 2:56276395-56276417 CCAAATCTCATCTTGAATTGTAA 0: 2206
1: 9725
2: 12425
3: 11533
4: 7780
Right 930881555 2:56276434-56276456 GTGTCGTAGGAGGAACTGGTGGG 0: 1
1: 0
2: 5
3: 58
4: 314
930881543_930881555 22 Left 930881543 2:56276389-56276411 CCCCACCCAAATCTCATCTTGAA 0: 7463
1: 11190
2: 9643
3: 7118
4: 4722
Right 930881555 2:56276434-56276456 GTGTCGTAGGAGGAACTGGTGGG 0: 1
1: 0
2: 5
3: 58
4: 314
930881546_930881555 17 Left 930881546 2:56276394-56276416 CCCAAATCTCATCTTGAATTGTA 0: 6802
1: 10434
2: 9513
3: 7783
4: 4679
Right 930881555 2:56276434-56276456 GTGTCGTAGGAGGAACTGGTGGG 0: 1
1: 0
2: 5
3: 58
4: 314
930881548_930881555 -9 Left 930881548 2:56276420-56276442 CCTGAAATTCCCACGTGTCGTAG 0: 1
1: 0
2: 5
3: 193
4: 1831
Right 930881555 2:56276434-56276456 GTGTCGTAGGAGGAACTGGTGGG 0: 1
1: 0
2: 5
3: 58
4: 314
930881545_930881555 20 Left 930881545 2:56276391-56276413 CCACCCAAATCTCATCTTGAATT 0: 7468
1: 11239
2: 9760
3: 8452
4: 6791
Right 930881555 2:56276434-56276456 GTGTCGTAGGAGGAACTGGTGGG 0: 1
1: 0
2: 5
3: 58
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930881555 Original CRISPR GTGTCGTAGGAGGAACTGGT GGG Intronic
900268226 1:1771699-1771721 ATGTAGTATGAGGAAGTGGTTGG - Intronic
900889540 1:5439747-5439769 GTGTCGTGGGAGGGACTTGGAGG - Intergenic
901162338 1:7188185-7188207 GTGTTGTGGGAGAGACTGGTGGG - Intronic
902064922 1:13677075-13677097 GTGTCGGAGGTAGAGCTGGTGGG - Intergenic
902154868 1:14477110-14477132 ATGTCGTGGAAGGAACTGGTGGG + Intergenic
902579909 1:17401849-17401871 ATGTCGTGGCAGGAAGTGGTTGG + Intergenic
902697155 1:18147858-18147880 GTGTCGTGGGAGGGACTTGGTGG + Intronic
904905804 1:33896494-33896516 GTGTCACAGGAGGGACTGCTGGG - Intronic
906186654 1:43867220-43867242 GTGTCGTGGGAGGAACCTGATGG - Intronic
908840353 1:68274149-68274171 GTGTCTCAGGAGCAACTGCTGGG - Intergenic
909265406 1:73551235-73551257 TTGTTGTGGGGGGAACTGGTGGG - Intergenic
909298559 1:73982707-73982729 GTGTGGTGGAAGGAACTGATGGG - Intergenic
909883051 1:80904671-80904693 GTGTCATGGGAGGGGCTGGTGGG - Intergenic
910647849 1:89532454-89532476 GTGTCGTGGGAGGGACTGGGTGG + Intronic
911134813 1:94428546-94428568 GTGTTGTAGGAGGGACTGGTGGG + Intronic
911135086 1:94430437-94430459 GTGTTGTAGGAGGGACAGGTGGG + Intronic
911236505 1:95418021-95418043 GTGTTGTGGGAGGACCTGGTGGG - Intergenic
912004222 1:104877408-104877430 GTGTTGTAGGAGGGACTTGGTGG + Intergenic
912263722 1:108133491-108133513 ATGTCATGGAAGGAACTGGTGGG - Intergenic
912521907 1:110251289-110251311 GTGTTGTGGGAAGACCTGGTGGG + Intronic
915326403 1:155083182-155083204 GTGTTGTAGGGGGAACTGGGCGG + Intronic
915876053 1:159613196-159613218 GTATTGTGGGAGGGACTGGTGGG - Intergenic
917411208 1:174761784-174761806 GTGTTGTGGGAGGAACTTGGTGG - Intronic
918079348 1:181193717-181193739 GTGTTGTGGGAGGTACTGGGTGG + Intergenic
918990644 1:191694122-191694144 GTGTCGTGGGAGGAACTTGGTGG - Intergenic
919290364 1:195622699-195622721 GTGTTGTAGGAGGAACCTGGTGG + Intergenic
920121433 1:203661637-203661659 GTGTGGTAGGAGACAATGGTGGG - Intronic
921715876 1:218416757-218416779 GTGTTGTGGGAGGGACTGGGTGG + Intronic
921723956 1:218504230-218504252 GTGTCATAGGAAGGACTGGATGG - Intergenic
921973970 1:221180915-221180937 GTGTGGTGGGAGGAACTATTAGG + Intergenic
922248761 1:223827016-223827038 GTGAGGAAGGAGGAACAGGTTGG + Intronic
924695606 1:246396643-246396665 GTGTTGAAGGAGGGCCTGGTGGG + Intronic
1063111226 10:3039146-3039168 GTGTTATGTGAGGAACTGGTGGG + Intergenic
1064793610 10:18987631-18987653 ATGTCATGGGAGGACCTGGTGGG - Intergenic
1065268317 10:24000258-24000280 GTGTCGTAGGAGGAAGCAGTGGG + Intronic
1065521307 10:26575947-26575969 GTGTGGAAGGAGGGACTTGTGGG - Intergenic
1065795237 10:29301081-29301103 GTGTTGTAGGAGGAACTCGGTGG + Intronic
1066083340 10:31954007-31954029 GTGTTGGGGGAGGAGCTGGTAGG + Intergenic
1066701638 10:38135860-38135882 GTGTTGTGAGAGGGACTGGTGGG - Intergenic
1069663169 10:70137345-70137367 GTGTCATGGGAGGAACTTGTTGG - Intergenic
1070226902 10:74517076-74517098 GTGTTGTGGGAGAGACTGGTGGG - Intronic
1071330688 10:84556255-84556277 GTGTTGAAGGAGGGCCTGGTGGG - Intergenic
1071367245 10:84911683-84911705 GTGTTGTGGGAGGAACCTGTTGG + Intergenic
1073981337 10:109157185-109157207 GTGTCACAGTAGGAGCTGGTGGG - Intergenic
1075562200 10:123476200-123476222 GTGTTGTAGGTGGGTCTGGTGGG + Intergenic
1075783787 10:125034227-125034249 GAGTCGGTGGAGGAACAGGTGGG + Intronic
1075815754 10:125263927-125263949 GTGTTGTTGCAGGAACTGCTGGG + Intergenic
1077979423 11:7285451-7285473 GTGTCATGGGAGGGACTGGTGGG - Intronic
1078324375 11:10367704-10367726 GTGTCGTGGGAGGAACCTGGTGG + Intronic
1079298335 11:19254771-19254793 ATGTCATGGGAGGAACTGGTGGG - Intergenic
1079989740 11:27234019-27234041 GGGTCATAGGAGAAACAGGTTGG - Intergenic
1080909967 11:36586488-36586510 GTGTTATGGGAGGAACTGGTGGG - Intronic
1081309924 11:41557668-41557690 GTGTAGTAGGAGGAACCTGGTGG + Intergenic
1081423478 11:42899649-42899671 GTGTCGTGGGAGGGACTTGGTGG + Intergenic
1081653059 11:44838394-44838416 GTGTCATGGGAGGAACCGGGTGG - Intronic
1082759701 11:57115424-57115446 GTGTCATGGGAGGAACTTGGTGG + Intergenic
1085146187 11:74199940-74199962 GTGTTGTGGGGGGACCTGGTTGG - Intronic
1085875874 11:80405445-80405467 GTGTCATGGGAGGGACTGGGTGG + Intergenic
1086816138 11:91373578-91373600 GTGTCGTGGGAGGAACCTGTTGG + Intergenic
1087011171 11:93515629-93515651 TTGGAGTAGGAGGAACTTGTAGG - Intronic
1087730967 11:101778408-101778430 GTGTCATGGGAGGGATTGGTGGG + Intronic
1088001164 11:104882721-104882743 GTGTCGTGGGAGGAACCTGGTGG + Intergenic
1088360252 11:108981750-108981772 GTGTTGTGGGAGGGACCGGTGGG + Intergenic
1088706221 11:112466856-112466878 GTGTTGTGGGAGGAACTCGGTGG - Intergenic
1090058199 11:123441310-123441332 GTGTAGGAGGAGAACCTGGTGGG - Intergenic
1090320577 11:125839802-125839824 GTGTTGTGGGAGGGACCGGTGGG - Exonic
1093038282 12:14353503-14353525 GTGTCATGGGAGGGACCGGTGGG - Intergenic
1093047910 12:14471780-14471802 GTGTGGTGGGAGGGACTGGGTGG - Intronic
1095360400 12:41331841-41331863 GTGTCATGGGAGGGACTGGATGG - Intronic
1095747709 12:45677946-45677968 GTGTTGTAGGACGCACCGGTGGG + Intergenic
1097538123 12:60899563-60899585 GTGTCGTGGGAGAGACTGGGTGG + Intergenic
1097933055 12:65212240-65212262 GTGTTGTGGGAGGCAGTGGTGGG - Intronic
1098083155 12:66811368-66811390 GTGTCTTAGGAGGAAAGAGTTGG + Intergenic
1098992010 12:77073954-77073976 GTGTCATGGGAGGAACCTGTTGG + Intergenic
1099076460 12:78114631-78114653 GTGTCATGGGAGGAACCCGTTGG - Intronic
1099271810 12:80520214-80520236 ATGTTGTTGGAGGGACTGGTAGG + Intronic
1099536943 12:83856518-83856540 GTGTCCTGGGAGTAACTGGTGGG + Intergenic
1100327623 12:93554113-93554135 GTGTTGTGGGAGGGACCGGTGGG - Intergenic
1101688230 12:107047479-107047501 GTGTCATGGGAGGAACTAGGTGG + Intronic
1102716568 12:114978570-114978592 GTGTTGTGGGAGGGACTGGGTGG - Intergenic
1103269163 12:119657820-119657842 GTGTCGTGGGAGGAATTTGGCGG - Intergenic
1104316709 12:127709930-127709952 GTGTCGTGGGAGGGACTCGGTGG - Intergenic
1104590117 12:130077652-130077674 ATGTCATGGGAGGATCTGGTGGG - Intergenic
1105539998 13:21307952-21307974 GTCTCTGAGTAGGAACTGGTGGG + Intergenic
1105991526 13:25626991-25627013 GTGTTGTGGGAGGGACTGGTGGG - Intronic
1106022040 13:25924752-25924774 GTGTCATGGGAGGACCCGGTGGG + Intronic
1107232745 13:38130062-38130084 GTGTTGTGGGAGGACCTGGTGGG + Intergenic
1107344116 13:39440787-39440809 GTGTCGTGGGAGGAACCTGGTGG + Intronic
1108011556 13:46018604-46018626 GTGTGGTAGGAGGAAGTTGAGGG + Intronic
1108118386 13:47155965-47155987 GTGTCATGGGAGGCACTGGGTGG + Intergenic
1109667724 13:65560308-65560330 GTGTCTTGGGAGGAACTTGGTGG - Intergenic
1109901931 13:68784864-68784886 GTGTTGGAGGTGGAACTAGTGGG + Intergenic
1110163084 13:72402657-72402679 GTGTCGTGGGAGGAACCTGATGG - Intergenic
1110218783 13:73051290-73051312 GTGTCGTGGGAGAAACTCGGTGG - Intergenic
1110439829 13:75515665-75515687 GTGTTGTGGAAGGACCTGGTGGG - Intergenic
1110920494 13:81078074-81078096 GTGTTGGAGGAGGGCCTGGTGGG - Intergenic
1111172725 13:84549965-84549987 ATGTTGTGGGAGGGACTGGTGGG - Intergenic
1111334119 13:86799534-86799556 GTGTTGTGGGAGGAACTTGGTGG + Intergenic
1112183002 13:97103634-97103656 GTGTTGTAGGAGCCACTGGGTGG + Intergenic
1112742373 13:102489675-102489697 GTATCGAGGGAGGGACTGGTGGG + Intergenic
1113252383 13:108468313-108468335 GTGTTGTGGGAGGAACCTGTTGG + Intergenic
1113373803 13:109745311-109745333 GTGGCGTGGTAGGATCTGGTTGG - Intergenic
1114345383 14:21789393-21789415 GTGTCATGGGAGGAACTTGGTGG + Intergenic
1114798012 14:25739250-25739272 GTGTCATGTGAGGAACTGGTGGG - Intergenic
1115318691 14:32054583-32054605 GTGTCATGGGAGGAACCGGGTGG + Intergenic
1115482732 14:33877777-33877799 GTGTCATGGGAGGACCTGGTGGG + Intergenic
1115625841 14:35191144-35191166 ATGTTGTAGGAGGAACTTGGTGG + Intronic
1117192812 14:53309784-53309806 GTGTTGTGGGAGGACCTGGTGGG + Intergenic
1118461580 14:65992252-65992274 GTGTTGGAGGAGGGCCTGGTAGG - Intronic
1118603401 14:67486173-67486195 ATGTTGTGGGAGGAACTGGGTGG + Intronic
1119322630 14:73740756-73740778 GTGTCAGAGGAGGCACTGGCTGG - Intronic
1120141210 14:80931975-80931997 GTGTCGTGGGAGAGACTGGTGGG + Intronic
1120742025 14:88118934-88118956 GTGTTGTGGGAGGGACTGGTGGG - Intergenic
1120984322 14:90320452-90320474 GTGTCAAGGGAGGAACTGGTGGG - Intronic
1121430396 14:93882395-93882417 GTGTCGTAGGAGGGACCTGGCGG - Intergenic
1121820776 14:96964323-96964345 GTGTGCTGGGAGGACCTGGTGGG + Intergenic
1122832037 14:104403061-104403083 GTGTTGCAGGAGGGCCTGGTGGG + Intergenic
1127237484 15:57070824-57070846 GAGGTGTAGAAGGAACTGGTGGG + Intronic
1127278499 15:57468768-57468790 ATGTTGTGGGAGGGACTGGTGGG + Intronic
1133647288 16:7776249-7776271 GTGTTGTGGGAGGAACTTGTTGG + Intergenic
1135982467 16:27158941-27158963 GTGTCATGGGACGGACTGGTGGG - Intergenic
1135994476 16:27237871-27237893 GTACAGTAGGAGGAAGTGGTTGG - Intronic
1136046832 16:27621909-27621931 GTGTCGAGGTAGGACCTGGTGGG - Intronic
1137265719 16:46867654-46867676 GTGTCGTAGGAGGAACTCAGTGG - Intergenic
1138518544 16:57555270-57555292 GTGTCATGGGAGGGACTGATGGG + Intronic
1138707093 16:58926607-58926629 GTGTCGTGGGAGGGACCAGTAGG + Intergenic
1139104930 16:63817264-63817286 GTGTCATAGGAGGAACCCGGTGG + Intergenic
1139114556 16:63933844-63933866 ATGTCGTGGGAGGGACTAGTTGG - Intergenic
1139171688 16:64638033-64638055 GTGTTGTGGGAGGGACTGGTGGG + Intergenic
1141240438 16:82260516-82260538 ATGTTGTGGGAGGGACTGGTGGG + Intergenic
1141336734 16:83162989-83163011 GTGTCGTAGGAGGAACCTGGTGG + Intronic
1146655090 17:34630308-34630330 GTGCTGTAGGAGGAAAAGGTGGG - Intronic
1147183471 17:38701574-38701596 CTGTTTCAGGAGGAACTGGTGGG - Intergenic
1147444638 17:40467390-40467412 GTATTGTAGGAAGAACTGATTGG - Intergenic
1149062814 17:52443672-52443694 GTGTCGTGGGAGGAACCTGGTGG + Intergenic
1150506377 17:65702925-65702947 GTGTCATGGGAGGGACTGGAAGG - Intronic
1151720906 17:75855463-75855485 GTTGCGCAGGAGGAACTGGAAGG - Exonic
1151726186 17:75885995-75886017 GTGTCGTGGGAGGGACTTGGTGG + Intronic
1152167020 17:78715958-78715980 GTGTTGTAGGAGGAAGCTGTGGG - Intronic
1152658365 17:81530410-81530432 GTGGGGAAGGAGGAACTGCTGGG - Intronic
1152664023 17:81557000-81557022 GTGTCCCAGGAGCAGCTGGTTGG + Exonic
1153987170 18:10362736-10362758 GTGTTGGAGGAGGGCCTGGTGGG + Intergenic
1154404372 18:14075168-14075190 GTGTTGTGGGAGGAACTTGGTGG - Intronic
1155675779 18:28426585-28426607 GTGTTGTGGGTGGACCTGGTGGG + Intergenic
1156543305 18:37938600-37938622 GTGTCGTGGGAGGAACTCGGTGG + Intergenic
1156901795 18:42308942-42308964 GTGTCATGGGAGGAACTTGGTGG - Intergenic
1157438380 18:47690422-47690444 ATGTCCTAGGAGGAGCTGGGTGG - Intergenic
1158299392 18:56034494-56034516 GTGTCGCAGGAGGAACCTGGTGG - Intergenic
1159507244 18:69353665-69353687 ATGTTGTGGGAGGACCTGGTGGG - Intergenic
1159762692 18:72448377-72448399 GTGTCGAGTGAGGGACTGGTGGG + Intergenic
1159996480 18:74970171-74970193 GTGTTGTGGGAGGGACTGGAGGG - Intronic
1161721880 19:5907391-5907413 GTGGTGTGGAAGGAACTGGTGGG + Intronic
1164549695 19:29198927-29198949 GTGTCAGAAGAGGAACTGCTGGG + Intergenic
1166431560 19:42732347-42732369 GTGTATGAGGAGGAAATGGTGGG + Intronic
1166434681 19:42757560-42757582 GTGTATGAGGAGGAAATGGTGGG + Intronic
1167208490 19:48118285-48118307 GTGTCGTGGAGGGACCTGGTGGG + Intronic
925504213 2:4542966-4542988 GTGTCATGGGAGGGACTTGTTGG + Intergenic
927030711 2:19118057-19118079 GTGTTGTGGGAGGGACTAGTGGG - Intergenic
927350259 2:22103957-22103979 ATGTCGTAGGATGAACCAGTGGG - Intergenic
927409142 2:22805399-22805421 GTGTCGTGGGAGGAACCTGGTGG - Intergenic
927409417 2:22807306-22807328 TTGTCATGGGAGGAACTGGTGGG - Intergenic
928610049 2:32983588-32983610 GTGTCGTAGGAGGGACCTGGTGG + Intronic
930682721 2:54274306-54274328 GTGTCATAGGAGGAACCTGGTGG - Intronic
930881555 2:56276434-56276456 GTGTCGTAGGAGGAACTGGTGGG + Intronic
932483111 2:72061598-72061620 ATGTCAAGGGAGGAACTGGTGGG - Intergenic
933031344 2:77332926-77332948 GTGTCATGGGAGGAACTAGGTGG + Intronic
935887174 2:107634900-107634922 GTGTCGAGGGAGGAACTTGGTGG - Intergenic
936659132 2:114522948-114522970 GTGTTGTAGGAGGAACTCAGCGG - Intronic
937753348 2:125505020-125505042 GTGTTGTGGGAGCAGCTGGTGGG - Intergenic
938241635 2:129746907-129746929 GTGTCGTGGGAGGAACCTGGTGG - Intergenic
938619414 2:133032995-133033017 ATGTTGTGGGAGGAGCTGGTGGG - Intronic
939033058 2:137099603-137099625 GGGTCGTAGGAGTTGCTGGTAGG - Intronic
939382940 2:141459573-141459595 GTGTTGTGGGAGGAACTCGGTGG + Intronic
939842653 2:147207401-147207423 GTGTTGTGGGAGGTACTGGTGGG - Intergenic
940036535 2:149318075-149318097 GTGTTGTGGGAGGAAATTGTGGG + Intergenic
941469043 2:165861805-165861827 GTGTTGTAGGAGGAACTCAGTGG + Intronic
941545962 2:166851728-166851750 GTGTCCTGAGAGGAACTAGTGGG - Intergenic
941916068 2:170814858-170814880 GGGTCAAAGGAGGAAGTGGTTGG + Intronic
942224540 2:173803834-173803856 GTGTTGGAGGAGGGGCTGGTGGG + Intergenic
943406528 2:187494213-187494235 ATGTTGTGGGAGGGACTGGTGGG - Intronic
944298929 2:198100493-198100515 GTGTGGGAGGAGGAACAAGTAGG + Intronic
944662780 2:201935111-201935133 GTGTTGTGGGAGGGACTTGTGGG - Intergenic
944999744 2:205335948-205335970 GTGTCATGGGAGGAACTGGCGGG - Intronic
945650036 2:212545862-212545884 CTGTCATGGGAGGACCTGGTGGG - Intergenic
946518235 2:220436812-220436834 GTGTCATAGGAGGGACTTGGTGG + Intergenic
947825030 2:233100051-233100073 GTGTCGTGGGAGGAACCCGGTGG - Intronic
948469002 2:238165541-238165563 GTGTCGTAGGTGAAGTTGGTGGG + Intronic
1170137573 20:13091617-13091639 TTTTCGTAGGAGAAACTGATTGG + Intronic
1170745058 20:19091680-19091702 GTGTCCTTGGAAAAACTGGTAGG - Intergenic
1170938691 20:20830867-20830889 GTGTCCGGGGAGGGACTGGTGGG + Intergenic
1172166883 20:32904945-32904967 GTGTAGTAGAAGGAGCTGGCGGG + Intronic
1172598832 20:36169536-36169558 GCCTGGAAGGAGGAACTGGTTGG - Intronic
1172720028 20:36992838-36992860 GTGTCGTGGGAGGAACCTGGTGG + Intergenic
1173252654 20:41372754-41372776 GTGTCGTGGGAGGAACCTGGTGG + Intergenic
1173537790 20:43829268-43829290 GTGTCATAGGAGGAACCTGGTGG - Intergenic
1173921767 20:46751491-46751513 GTGTTGGAGGAGGGACTGGTGGG - Intergenic
1173941471 20:46914675-46914697 GTGTCGTGGGAGGGACTAGGTGG - Intronic
1174117099 20:48233959-48233981 GTGTTGGAGGAGAACCTGGTGGG - Intergenic
1174390236 20:50214440-50214462 GAATGGGAGGAGGAACTGGTTGG + Intergenic
1174532384 20:51224388-51224410 ATGTTGTAGGAGGGACTGGTAGG + Intergenic
1175183367 20:57163952-57163974 GTGTCGTGGGAGGAACTCGGTGG + Intergenic
1175290761 20:57873624-57873646 GTGCTGTAGAAGGCACTGGTAGG + Intergenic
1175419211 20:58820853-58820875 GTGTCATGGGAGGAACTGGGTGG - Intergenic
1177076741 21:16584719-16584741 GTGGACTAGGATGAACTGGTTGG - Intergenic
1177197478 21:17918563-17918585 GTGTCCTAGGAGGAACCCGGGGG - Intronic
1177222814 21:18216899-18216921 GTGTCATGGGAGGAACCTGTTGG - Intronic
1177334522 21:19706657-19706679 GTGTTGTAGGAGGAACCTGGTGG + Intergenic
1178002668 21:28181521-28181543 GTATCAAAGGAGGACCTGGTAGG + Intergenic
1178127958 21:29536261-29536283 GTGTTGTAGGAGGAATTTGGCGG + Intronic
1178468385 21:32869764-32869786 GTGTCAAGGGAGGACCTGGTGGG + Intergenic
1178939607 21:36894014-36894036 GTGTTGGAGGAGGGCCTGGTGGG + Intronic
1182041920 22:27244888-27244910 GAGTCGTAGGAAGAACTTTTTGG + Intergenic
1182751438 22:32644967-32644989 ATGTCGTAGCAGGAAGTGGTTGG + Intronic
1182816656 22:33170479-33170501 GTGTCGGAGGAGAGACTGGTGGG + Intronic
1185043447 22:48517413-48517435 GTGTCCCAGGAGGAGGTGGTGGG - Intronic
1185335125 22:50267935-50267957 GCGTCGTAGGCCGAACTGGAAGG + Exonic
949858944 3:8487925-8487947 ATGTCTTCGGAGGACCTGGTGGG + Intergenic
949941367 3:9157367-9157389 GTGTTGGAGGGGGACCTGGTGGG - Intronic
951486849 3:23222427-23222449 GTGTTGTGGGAGGGACTGGCGGG + Intronic
951902820 3:27673786-27673808 GTGTTGGAGAAGGAACTGGGGGG + Intergenic
952104898 3:30057898-30057920 GTGTCGAGGAAGGGACTGGTGGG + Intergenic
952822643 3:37498471-37498493 GAGTGGTAGGAGGAACCGGCGGG + Intronic
953392853 3:42543874-42543896 GTGGCGGAGTTGGAACTGGTGGG - Intergenic
954502843 3:51036771-51036793 GTGTCATGGGAGGAACCTGTGGG + Intronic
955604727 3:60689006-60689028 GTGTTGTAGGAGGGACTTGGTGG + Intronic
956664149 3:71626516-71626538 GTGTTGTGGGAGGGACTGGTGGG - Intergenic
956974670 3:74565871-74565893 ATGTCATGGGAGGGACTGGTAGG + Intergenic
957461622 3:80528798-80528820 GTGTTGTAGGAGGGACTTGGTGG - Intergenic
957474559 3:80706445-80706467 ATGTCCTGGGAGGCACTGGTGGG - Intergenic
957746202 3:84346766-84346788 GTATTGGAGGAGGACCTGGTGGG - Intergenic
957949655 3:87107969-87107991 GTGTTGTGGGAGGGACTGGTGGG + Intergenic
958049279 3:88323739-88323761 GTGTCGAAGGGGAACCTGGTGGG + Intergenic
958537830 3:95426511-95426533 GTGTCAAAGGAGGAACTTGGTGG - Intergenic
958543557 3:95510807-95510829 GTGTTGTGGGAGGGACAGGTGGG + Intergenic
958597185 3:96242033-96242055 GTGTTGTAGTAGAAACTGGTGGG - Intergenic
959760510 3:109957762-109957784 GTATCATGGGAGGGACTGGTGGG - Intergenic
960216426 3:115043848-115043870 GTGTTGGAGGAGGGCCTGGTGGG + Intronic
961029895 3:123592513-123592535 GTGTTGAGGGAGGGACTGGTGGG - Intergenic
961210765 3:125123729-125123751 GTGTCGTGGGAGGAACCTGGTGG - Intronic
963253571 3:143122083-143122105 GTGCGGTACGAGGACCTGGTGGG + Exonic
964696414 3:159512836-159512858 GTGTAGTGGGAGGCAGTGGTGGG - Intronic
965508927 3:169547099-169547121 GTGTTGAGGGAGGAACTTGTTGG + Intronic
966792630 3:183687755-183687777 GTGTCGTGGGAGGAACCTGGTGG + Intergenic
967418016 3:189240683-189240705 GTGTCGTGGGAGGAACCCGGTGG - Intronic
967854620 3:194107248-194107270 ATGTCATGGGAGGACCTGGTGGG + Intergenic
968265441 3:197359383-197359405 GTGTCGTGGGAGGAACTCCGTGG + Intergenic
969073053 4:4555218-4555240 GAGTTGTGGGAGGGACTGGTGGG - Intergenic
969128868 4:4975680-4975702 GTGTTGAAGGAGGGCCTGGTGGG + Intergenic
969843468 4:9900908-9900930 GTGTCATGGGAGGGACCGGTGGG - Intronic
970214643 4:13745952-13745974 GTGTTGTGGGAGGACCCGGTGGG - Intergenic
970917322 4:21351274-21351296 ATGTCGTAGGAGGAACCTGGTGG + Intronic
972014310 4:34225031-34225053 GTGTTGTAGGAGGGACTTGGTGG + Intergenic
972202542 4:36732264-36732286 GTGTTGTGGCAGGGACTGGTGGG - Intergenic
972799638 4:42461354-42461376 GTGTTGTGGGAGGGACTGGTGGG + Intronic
972945983 4:44256169-44256191 ACGTCGTGGGAGGGACTGGTGGG - Intronic
973604884 4:52576713-52576735 GTGTTGTGAGAGGATCTGGTGGG - Intergenic
974517588 4:62936995-62937017 ATGTCATGGGAGGAACTTGTTGG + Intergenic
974746437 4:66084174-66084196 GTGTTGTGGGAGGATCTGGTGGG + Intergenic
976026898 4:80698891-80698913 GTGTTGAAGGGGGACCTGGTGGG - Intronic
976150787 4:82089251-82089273 GTGTCGAGGGAGGATCTAGTGGG - Intergenic
978645083 4:110920512-110920534 GTGTTGGAGGAGGGACTTGTTGG + Intergenic
978991108 4:115083640-115083662 GTGTTGTAGGAGGGACCTGTTGG + Intronic
979102898 4:116644932-116644954 ATGTCATGGGAGGGACTGGTGGG + Intergenic
980727976 4:136788716-136788738 GTGTCGTGGGAGGAACCTGGTGG + Intergenic
981115107 4:140980558-140980580 GTGTAGTGGGAGGAGCTGGGTGG + Intronic
981121135 4:141052149-141052171 GTGTCATGGGAGGAAGTGGTGGG - Intronic
982208780 4:153018423-153018445 GTGTCAAGGGAGGACCTGGTGGG - Intergenic
982310150 4:153975834-153975856 GTGTTGTGGCAGGAACTGGGTGG + Intergenic
982436554 4:155387608-155387630 GTGTGGTGGGAGGAGCTGGGTGG - Intergenic
983322580 4:166212968-166212990 GTGTCATAGGAGGAACCAGGTGG - Intergenic
985976706 5:3424862-3424884 GTGTGGAAGCAGCAACTGGTTGG - Intergenic
986302560 5:6489843-6489865 GTGTTGTAGGAGCTGCTGGTGGG + Intronic
986546430 5:8903089-8903111 GTGTCCTGTGAGGACCTGGTGGG - Intergenic
987968447 5:24908691-24908713 GTGTCCTGGGAGGGACTGGGTGG - Intergenic
988723234 5:33900098-33900120 GTGTGGGAGGATGAACTAGTGGG + Intergenic
988871399 5:35394241-35394263 GTGTCGTGGGAGGAACCCGGTGG - Intergenic
989279632 5:39626185-39626207 GTGTTGTGGGAGGGACTTGTTGG - Intergenic
989516196 5:42346990-42347012 GTGTTGTGGGAGGGACTGGTGGG + Intergenic
992087070 5:73287451-73287473 ATGTCGTTGGGGGTACTGGTGGG + Intergenic
992349547 5:75915093-75915115 GTGTTGTAAGAGGAACTTGGTGG - Intergenic
992412353 5:76518488-76518510 GTGTTGTGGGAGGGGCTGGTTGG - Intronic
993208924 5:84922206-84922228 GTGTTGTGGGAGGGACTTGTTGG + Intergenic
994383424 5:99099196-99099218 GTGTTGAAGGAGGAACAGGTGGG + Intergenic
994597459 5:101858227-101858249 GTGTCATAGGAGGCACCTGTTGG - Intergenic
994849368 5:105035218-105035240 GTGTTGTGGGAGGGACTGGTGGG - Intergenic
995089201 5:108152923-108152945 GTGTCGTGGGAGGAACCTGGTGG + Intronic
995090629 5:108171809-108171831 GTGTTGTGGGAGGACTTGGTGGG + Intronic
997108397 5:131047057-131047079 GTGTTGTAGGAGGGACCGGGGGG - Intergenic
998324740 5:141269960-141269982 GTATCATATGAGGAACTGCTTGG - Intergenic
999805089 5:155073643-155073665 GTGTCATGGTAGGACCTGGTGGG - Intergenic
1000358416 5:160423196-160423218 GTGCCTTAAGAGAAACTGGTTGG + Intronic
1001910209 5:175510437-175510459 GTGCCTTTGGAGGTACTGGTAGG + Intronic
1003034147 6:2628463-2628485 GAGTAGTAGGAGGAAGAGGTGGG + Intronic
1004747168 6:18522614-18522636 GTGTCGTGGGAGGAACCTGGTGG + Intergenic
1005002338 6:21254769-21254791 GTATTGTGGGAGGTACTGGTGGG - Intergenic
1005173454 6:23015054-23015076 ATGTCATAGGAGGAAGTGGAAGG + Intergenic
1007461369 6:42021608-42021630 ATGTGGGAGGAGGAACTGGGTGG + Intronic
1010735734 6:79442354-79442376 GTGTCGTGGGAGGAACCTGGTGG - Intergenic
1011088469 6:83569676-83569698 GTGTTGTGGGAGGGCCTGGTGGG + Intronic
1011240545 6:85267452-85267474 GTGTTGTGGGAGGGACTGGGTGG - Intergenic
1012195301 6:96334606-96334628 GTGTTGTAGGAGGAACCTGGTGG + Intergenic
1013465048 6:110410726-110410748 GTGTCGTGGGAGGAACCTGGTGG - Intronic
1015329556 6:131961649-131961671 GTGTTGGAGGTGGAGCTGGTGGG + Intergenic
1015753462 6:136584604-136584626 GTGTCGTGGGAGGAACCTGGTGG - Intronic
1015825107 6:137302895-137302917 GTGTCATGGGAGGGACTGGGTGG + Intergenic
1016000653 6:139037683-139037705 GTGTGGGAGGAGGAACAGGAGGG - Intronic
1016585729 6:145682309-145682331 GTGTTGTAGGAGAGACTAGTGGG - Intronic
1017549713 6:155493086-155493108 GTGTCGTAGAAGGGACTGGTGGG + Intergenic
1017640534 6:156489699-156489721 ATGTGGTTGGAGGACCTGGTAGG + Intergenic
1017675062 6:156804694-156804716 GTGTTGTAGGAGGGACTTGGTGG - Intronic
1017768079 6:157623225-157623247 GTGTGGTGGGAGGAGCTGGTGGG + Intronic
1020837104 7:13167734-13167756 ATGTTGTAGGAGGAACTTGGTGG - Intergenic
1021598750 7:22343281-22343303 GTGTTGTAGGAGGAACCCGGTGG - Intronic
1021646939 7:22797873-22797895 GTGTCATGGGAGGAACTTGGTGG - Intergenic
1022480002 7:30736698-30736720 AGGTCGTGGGAGGGACTGGTGGG + Intronic
1023168564 7:37367664-37367686 GTGTGGTAGGAAAAACTGGTGGG + Intronic
1024415854 7:49106665-49106687 GTGTAGTAGGAGGGACTTGGTGG + Intergenic
1024459775 7:49648201-49648223 GTGTTGGAGGAGGGCCTGGTGGG - Intergenic
1024757438 7:52552182-52552204 GTGTAGTGGGAGGGACTGGTGGG + Intergenic
1024771200 7:52725207-52725229 GTGTTGTGGGAGGGACTGGTGGG - Intergenic
1026341746 7:69440213-69440235 GTGTTGTAGGAGGAACCTGGTGG - Intergenic
1026592424 7:71708450-71708472 GTGTTGTGGGAGGGACCGGTGGG - Intronic
1027605234 7:80291887-80291909 GTGTCGTGGGAGGAACCTGGTGG - Intergenic
1029851606 7:103466997-103467019 GTGTTGTGGGAGGACCTGGGAGG - Intergenic
1030850926 7:114486379-114486401 GTGTTGTGGGAGAAACTGGTGGG - Intronic
1030967559 7:116011705-116011727 GTGTTGGAGGAGGACCTAGTGGG + Intronic
1031432081 7:121684278-121684300 GTGTTGTGGGAGGAACCGGTGGG - Intergenic
1032053290 7:128663224-128663246 GTGTTGTGGGAGGGACAGGTGGG + Intergenic
1032802956 7:135331051-135331073 CTGTGGTAGGAGGAACCCGTTGG + Intergenic
1033221404 7:139528615-139528637 GTGTCATGGGAGGGACTGGGTGG - Intronic
1034011101 7:147530626-147530648 GTGTTGTAGGAGGGACTGAGGGG - Intronic
1035790660 8:2301444-2301466 ATGTCATAGGAGGACGTGGTGGG - Intergenic
1035802145 8:2420261-2420283 ATGTCATAGGAGGACGTGGTGGG + Intergenic
1036402841 8:8425778-8425800 CTGTGGTAGGAGGGACTGTTTGG + Intergenic
1036814380 8:11890342-11890364 GTGTCGTGGGAGGAACCTGGTGG + Intergenic
1038594533 8:28875117-28875139 GTGTTGTGGGAGGGATTGGTGGG - Intronic
1038876088 8:31551198-31551220 GTGTCATGGGAGGGACTGGGTGG + Intergenic
1038940720 8:32301796-32301818 GTGTTGTGGGAGGAACCCGTGGG - Intronic
1039310510 8:36313543-36313565 GTGTTGCAGGAGGACCTGGTGGG - Intergenic
1040610419 8:48977462-48977484 CTGTCCCAGGAGGAACTGGGAGG - Intergenic
1041020405 8:53632895-53632917 GTGTCGTGGGAGGTACTTGGTGG - Intergenic
1041115476 8:54531566-54531588 ATGTCGTGGGAGGAACTGGTGGG + Intergenic
1041430800 8:57778557-57778579 GTGTCATAGGAGGGACCTGTTGG + Intergenic
1042737072 8:72001316-72001338 GTGTGGAAGGAGGGATTGGTGGG + Intronic
1043066419 8:75576663-75576685 ATGTCGTGGGAGGGACTGGTGGG - Intergenic
1046917265 8:119691024-119691046 GTGTCATAGGAGGGACTTGGTGG + Intergenic
1047565711 8:126041309-126041331 GTGTCGTGGGAGGAACCTGATGG + Intergenic
1049345698 8:142137501-142137523 GTGTCGTGGGAGGGACTGGGTGG - Intergenic
1051355829 9:16239103-16239125 GTGTCGTGGGAGGAACCTGGTGG + Intronic
1051860968 9:21624278-21624300 GTGTCGTGGAGGGATCTGGTGGG - Intergenic
1054985065 9:71252462-71252484 GTGTTGATGGAGGAACTTGTTGG - Intronic
1055185811 9:73452672-73452694 GTGTTGGAGGAGGGTCTGGTGGG + Intergenic
1055627962 9:78194070-78194092 GTGTCCTGGGAGGGACTGGGTGG - Intergenic
1055914141 9:81382970-81382992 GTGTTGTGGGAGGGACTGGTGGG - Intergenic
1056689645 9:88796392-88796414 GTGTTGTGGGAGAAACCGGTTGG - Intergenic
1058072191 9:100612564-100612586 GTGTTGTAGGAGGAACTTGGTGG - Intergenic
1185679791 X:1879224-1879246 GTGTTGTGGGAGGGACTGGGTGG - Intergenic
1185969601 X:4647811-4647833 GTGTAGTGGGAGGAGTTGGTGGG - Intergenic
1186006351 X:5076678-5076700 CTGTTGTAGGAGGGACTGGGTGG + Intergenic
1186291806 X:8108451-8108473 GTGTTGTGGGAGGAACTTGGTGG - Intergenic
1186980902 X:14956410-14956432 CTGTTGTGGGAGGACCTGGTGGG - Intergenic
1188231605 X:27670668-27670690 GTGTTGGAGGGGGACCTGGTGGG + Intronic
1189048027 X:37614049-37614071 GTGTCCTGGGATGAACTGGCAGG - Intronic
1189123327 X:38418629-38418651 ATGTTGTGGGAGGGACTGGTGGG + Intronic
1189500614 X:41552907-41552929 GTATTTTAGGAGGAACTGGCAGG + Intronic
1190138670 X:47820494-47820516 GTGTTGTGGAAGGACCTGGTGGG + Intergenic
1193167804 X:78302061-78302083 GTGTCGTGGGAGGAACCTGGTGG - Intronic
1193506114 X:82347298-82347320 ATGTCGTGGGAGGGACTGATGGG - Intergenic
1194064301 X:89242407-89242429 TTGTTGGAGGAGGGACTGGTGGG + Intergenic
1194154966 X:90376289-90376311 GTGTCGAGGGAGGAACTGGTGGG - Intergenic
1195124890 X:101798378-101798400 GTGTTGAGGGAGGAACTGGTCGG + Intergenic
1195545079 X:106105037-106105059 GTGTTGTGGGAGGGACTGGTGGG + Intergenic
1197856857 X:130922527-130922549 GTGTCATGGGAGGGACCGGTTGG + Intergenic
1198888330 X:141363349-141363371 ATGTCGTGGGAGGAACTTGGCGG - Intergenic
1199106704 X:143876606-143876628 GTGTCGTGGGAGGAACCCGGTGG + Intergenic
1199318141 X:146404506-146404528 GTGTGGTAGGAGGGACCGATGGG + Intergenic
1200501314 Y:3953175-3953197 GTGTCGAGGGAGGAACTGGTGGG - Intergenic
1200718475 Y:6576506-6576528 TTGTTGGAGGAGGGACTGGTGGG + Intergenic