ID: 930883620

View in Genome Browser
Species Human (GRCh38)
Location 2:56299466-56299488
Sequence CCTGAGGCTGCACTCTGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 189}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930883620 Original CRISPR CCTGAGGCTGCACTCTGTTC TGG Intronic
900156398 1:1204987-1205009 CCTGGGGCTGCACCCTGTTCTGG - Intronic
900992469 1:6104349-6104371 CCTGAGGCTGCACTCTTGGAAGG - Exonic
901202092 1:7472801-7472823 GCTGTGGCTGGGCTCTGTTCTGG - Intronic
902222588 1:14976480-14976502 CCTGAGTCTGAACCATGTTCTGG - Intronic
904390253 1:30180259-30180281 CCTGAGGCTGGAGTGTGTTGCGG - Intergenic
904399782 1:30248453-30248475 CCTGAGGCTGGACTTTGCTACGG - Intergenic
906141193 1:43534566-43534588 CCTGAAGCTTCACTGTGTTAGGG + Intronic
908632155 1:66121093-66121115 CCTGAGGCAGCACTATTTTCTGG - Intronic
911357763 1:96843188-96843210 TATGGGGCTGCACTCTCTTCTGG - Intergenic
911714697 1:101118035-101118057 CCTTAGGCTGGAATCTGTGCTGG - Intergenic
912617015 1:111112416-111112438 CCTGATGCTGCAGGCTGTACAGG - Intergenic
916497101 1:165356133-165356155 CCTGGCGCTGCGCTCTGTTGGGG + Intronic
918962871 1:191303140-191303162 GCTGAGGCTGCACTGTTTGCTGG + Intergenic
919017867 1:192063864-192063886 CCATAGACTTCACTCTGTTCTGG + Intergenic
919660068 1:200235716-200235738 CCTGAAGCTTGACTCTTTTCTGG + Intergenic
919775749 1:201192968-201192990 GCTGAGCCTGCACACTGTGCTGG - Intronic
920441985 1:205986845-205986867 CCTCGGCCTGCACTGTGTTCTGG - Intronic
920865742 1:209751836-209751858 CCTGAGGCTGCAGCCTGTCAAGG + Intergenic
922563803 1:226588179-226588201 CATGAGGCTGCACACAGTGCTGG + Intronic
923462528 1:234219619-234219641 GCTGAGGGTGAACTCAGTTCTGG + Intronic
924795046 1:247286949-247286971 CCTGAGCCTACCCTCTGTTATGG + Intergenic
1063007642 10:1989214-1989236 CCTGAGGATGCATTTGGTTCAGG + Intergenic
1066287083 10:33978826-33978848 CTTGAGGCTGCATTCTCTGCAGG - Intergenic
1066468316 10:35672416-35672438 CCTGAAACTTCACTCTGTACAGG - Intergenic
1067180518 10:43982407-43982429 TCTGAGGCTGGCCTCTGTTTAGG + Intergenic
1068053681 10:51983450-51983472 CCTGAGGCTGCACTGTAAGCAGG + Intronic
1069881868 10:71598242-71598264 TCAAAGGCTGCCCTCTGTTCTGG + Intronic
1070452506 10:76576034-76576056 CCTAATGCTGGACTATGTTCTGG - Intergenic
1072450028 10:95532365-95532387 ACAGAGCCTCCACTCTGTTCAGG + Intronic
1075709261 10:124522023-124522045 CCCGAGGCTTCACTCTCTTTGGG - Intronic
1077162436 11:1119873-1119895 GCTGAGGCTGCACCGTGCTCAGG + Intergenic
1077412411 11:2409849-2409871 CCTGAGGCAGCACTCGGAGCAGG + Intronic
1078079334 11:8192702-8192724 CCAGAGGCTGCACTAAGTTCAGG - Intergenic
1082660799 11:55908442-55908464 CCTTAAGCTACACTCTGTTTAGG + Intergenic
1083354688 11:62057529-62057551 CCTGAGGCTACATTTTGATCTGG + Intergenic
1083620074 11:64044881-64044903 CCTGAGGCCCCACTGTGTGCTGG + Intronic
1085066060 11:73497129-73497151 CCTCAGGCCTCACTCTGTTTTGG + Intronic
1090239479 11:125171992-125172014 CCTGTGACTCCACTCTGTCCTGG - Intronic
1092979382 12:13778445-13778467 CCTAAGGCTGGCTTCTGTTCTGG - Intronic
1093570496 12:20661548-20661570 CCCTAGGCTGCACACTGCTCAGG - Intronic
1094511688 12:31101106-31101128 TCTGAGGCAGCTCTCTTTTCTGG - Exonic
1100586907 12:95988951-95988973 CTAGAGGCTGGATTCTGTTCTGG + Intronic
1100819199 12:98415313-98415335 CCTGAGGCAGAACACTTTTCAGG - Intergenic
1101397691 12:104362996-104363018 CCTGAGGCTTCTCTCTGCTGCGG + Intergenic
1102659513 12:114513719-114513741 CCTGAGACTGCCCTATGGTCAGG + Intergenic
1102668917 12:114600796-114600818 CCTGAGGCTGCACACAGCTGTGG - Intergenic
1104452065 12:128877850-128877872 CATGAGGCTGCAGTCTTATCTGG + Intronic
1104976271 12:132553309-132553331 CCTGAGCCTGCACTTTGACCTGG + Intronic
1105603023 13:21903766-21903788 CCTGAGCATTCACTATGTTCAGG + Intergenic
1105644592 13:22303439-22303461 CCTGAGGCTGCACACAGTAGGGG + Intergenic
1106129864 13:26931332-26931354 CCTGAGGTTGGATTCTGGTCAGG + Intergenic
1107263542 13:38524002-38524024 CCTGAGAGAGCGCTCTGTTCGGG - Intergenic
1109226598 13:59703892-59703914 CCTGAGGATTCACTTTCTTCTGG + Intronic
1109523594 13:63545206-63545228 CTTGCAGCTGCACACTGTTCTGG - Intergenic
1113531547 13:111031149-111031171 GCTGAGGGTGAACTCTGCTCGGG - Intergenic
1113758615 13:112832242-112832264 CCCGAGGCTGCCCTGTGTGCGGG - Intronic
1115003731 14:28454783-28454805 CCTGAAGCAGCCCTGTGTTCTGG - Intergenic
1115642605 14:35344264-35344286 CTTGGTGCTGCCCTCTGTTCTGG + Intergenic
1115868964 14:37778763-37778785 TCTGAGGCTGCACTATGAGCAGG + Intronic
1118941716 14:70345435-70345457 CCTGAGCCTACCCTCTGTTATGG + Intronic
1119900694 14:78257099-78257121 TCAGAGGCCTCACTCTGTTCAGG + Intronic
1120334343 14:83134395-83134417 CCTGAGTCTGCAGTCATTTCAGG - Intergenic
1122603400 14:102932182-102932204 CCCAAGGATGCCCTCTGTTCAGG + Intronic
1126950139 15:53871683-53871705 CCTGTGGCTGGACTTGGTTCAGG + Intergenic
1127016562 15:54695281-54695303 CCCGAGGTTCCACTCTGTCCAGG - Intergenic
1132179987 15:99744999-99745021 CCGGTGGCTTCCCTCTGTTCCGG - Intergenic
1138906472 16:61340961-61340983 ACTGAGGCTTCACTGTGTGCAGG + Intergenic
1139441225 16:66968447-66968469 CATGAGGCTGCACCCGGTCCTGG + Intronic
1141501766 16:84449574-84449596 CCTGAGCCTTGACTCTGTTTCGG + Intronic
1143927996 17:10390062-10390084 CCTGAGGCTGCCCTCTGTATGGG - Intergenic
1144377339 17:14657423-14657445 CCTGAAGCTGCCCTTTGATCTGG - Intergenic
1146717375 17:35097992-35098014 GCTGCCACTGCACTCTGTTCCGG - Intronic
1147157179 17:38549849-38549871 CCCCAGGCTGGACCCTGTTCAGG + Intronic
1149646715 17:58246491-58246513 CCTGGGGCTGGGCTCTGTTGGGG - Intronic
1150774778 17:68070888-68070910 CCTGACCATGCACACTGTTCCGG - Intergenic
1151757641 17:76083750-76083772 CCTGAGGAGGCACTGTGGTCAGG + Exonic
1152125178 17:78442385-78442407 CCTGAGGCTGGCCCCAGTTCAGG - Intronic
1152529356 17:80907939-80907961 CCTGAGGCCGCACGCTGTCGTGG + Intronic
1152561665 17:81081812-81081834 CCTGGGGCTGCACTGCGGTCAGG - Intronic
1152733390 17:81984668-81984690 CCTGAGGCTGCAGTCAGGTTCGG + Intronic
1154095444 18:11410388-11410410 CCCGATGCTGCAGTCTGCTCAGG + Intergenic
1155558571 18:27049968-27049990 CCGGAGCCTGCACTTTGTTGAGG - Intronic
1158152291 18:54386907-54386929 CTTGCAGCTGCACTCTCTTCTGG + Intergenic
1159717941 18:71849116-71849138 CCTGAGGCTGCACAGAGTTGGGG - Intergenic
1159954413 18:74509239-74509261 ACAGAGCCTGCACTATGTTCTGG - Intronic
1160520871 18:79507281-79507303 CCCGAGGCTGCACTCAGAGCTGG + Intronic
1161459646 19:4389202-4389224 CCTGAGGCTGGGCTGTGCTCGGG - Intronic
1161645464 19:5450831-5450853 CCTGAGGCTGCACCCTGGCTGGG - Intergenic
1162079082 19:8208435-8208457 CCTGGGGCTGTCCTCTGTTCAGG + Intronic
1164915766 19:32051324-32051346 CATGGGGCCACACTCTGTTCCGG - Intergenic
1164933714 19:32195227-32195249 CCTGACCCTGCACACTGTGCAGG + Intergenic
1166190749 19:41174999-41175021 CCAGAGGGTCCACTCTGTTCTGG + Intergenic
1168355697 19:55698377-55698399 CCTGGGTCTCGACTCTGTTCAGG + Intronic
927860954 2:26559572-26559594 CCTGATGCTGGAATCTGTGCAGG + Intergenic
928399369 2:30966718-30966740 GCAGAGGCTTCACTGTGTTCTGG + Intronic
930883620 2:56299466-56299488 CCTGAGGCTGCACTCTGTTCTGG + Intronic
931755402 2:65369646-65369668 CCTGAAGCTGCTCTGTGGTCAGG - Intronic
932137490 2:69243824-69243846 TCTGAGGCTGCCCTCTATGCTGG - Intronic
936154180 2:110037424-110037446 TCTGAGGATGGAGTCTGTTCTGG + Intergenic
936190504 2:110333991-110334013 TCTGAGGATGGAGTCTGTTCTGG - Intergenic
936592361 2:113816359-113816381 GTTGAAGCTGCACTGTGTTCAGG + Intergenic
937284111 2:120739167-120739189 CCAGGGGCTGCACTGTGTACAGG - Intronic
938835940 2:135104190-135104212 TCAGAGGCTGCACACTGTTGAGG + Intronic
939134092 2:138273580-138273602 CTTGCAGCTGCACTCTCTTCTGG - Intergenic
941640864 2:167986899-167986921 CCTAAGTCAGCACTCTTTTCTGG - Intronic
944458476 2:199919469-199919491 TCTTAGGCTGGACCCTGTTCTGG + Intronic
944800969 2:203237955-203237977 GCGGAGGCTGCACACTGTTCAGG - Intergenic
1170761408 20:19254427-19254449 TCTGAGGCTGCACTCAGGTTGGG + Intronic
1170823349 20:19772649-19772671 CCTGAGCCAGACCTCTGTTCAGG + Intergenic
1172486283 20:35299681-35299703 TCTGTGACTGCACTCTCTTCAGG + Intergenic
1173010387 20:39176653-39176675 GCTGAGCCAGCACTCTGTCCTGG + Intergenic
1173788382 20:45811822-45811844 CCAGAGGCTGCACTCTAGCCTGG - Intergenic
1174037878 20:47679195-47679217 CCTGAGGCTGCACTGTGCCTGGG - Intronic
1174782312 20:53401142-53401164 CCTGAGGCGGTGCTCTGTTTGGG + Intronic
1175458437 20:59132855-59132877 GCTGAGGCTCCACTCTGCTGAGG + Intergenic
1175550160 20:59812381-59812403 CCTGAGGGTGCAGCGTGTTCTGG - Intronic
1179617893 21:42593592-42593614 CCTGGGGCTGCACTCAGTCCTGG + Intergenic
1180119330 21:45736440-45736462 CCTCAGGATGCACTGTGCTCAGG - Intronic
1181468098 22:23121194-23121216 CCTGAGGCTGCTCACTCCTCAGG + Intronic
1182284045 22:29233564-29233586 CCTGAGATTGTACTTTGTTCCGG + Intronic
1183698505 22:39436806-39436828 CCCAAGGCTGTCCTCTGTTCTGG + Intronic
1184198325 22:42947172-42947194 CAGGAGGCTGCCCTTTGTTCAGG + Intronic
1185273455 22:49939072-49939094 CCTGGGGCAGGACTCTGTTTAGG + Intergenic
1185379696 22:50502752-50502774 CCTGAGGCTCCTCTGTGATCAGG + Intergenic
952634905 3:35517491-35517513 CCTGGGATAGCACTCTGTTCTGG + Intergenic
952884933 3:38006427-38006449 CCTGAGGCTCCTCTCTGGACAGG + Exonic
954705948 3:52480566-52480588 CCTGAGGCTGCCCTCTGAACAGG + Intronic
955398710 3:58575834-58575856 CCTCAGGCTGGTCTCTGTTTAGG + Intronic
957000513 3:74878005-74878027 CTTGCAACTGCACTCTGTTCTGG - Intergenic
958923918 3:100137025-100137047 CCTGAGACTGAACTCTGTGAAGG - Intronic
959456298 3:106566614-106566636 CCTGAGGGTGGACTTTGTTAAGG - Intergenic
961654919 3:128435890-128435912 CCTGAGGCTGTACTAAGTGCTGG - Intergenic
962095603 3:132289507-132289529 CCTGAGGCCACATTCTTTTCTGG + Intergenic
962409855 3:135131583-135131605 CCTGAGGCTATGATCTGTTCTGG + Intronic
962700976 3:137999475-137999497 CCTGAAGATGGAATCTGTTCAGG - Intronic
964689120 3:159430444-159430466 CCTGAGGCTACGTTCTGCTCTGG + Intronic
968961754 4:3749095-3749117 TCTGCAGCTGCACTCTGGTCTGG - Intergenic
969489563 4:7491320-7491342 CCTGAGGCTGCACTGGGCTGGGG + Intronic
973645747 4:52949868-52949890 CCAGAGGCTGCACTTCTTTCTGG - Intronic
974487544 4:62524792-62524814 CCTTAGGCTGCACACAGCTCAGG - Intergenic
974487856 4:62526958-62526980 CTTGCAGCTGCACTCTCTTCTGG - Intergenic
975126612 4:70789486-70789508 CCTAAGTCTGAACTCTGTTATGG - Exonic
979751335 4:124282702-124282724 GCTGTTGCTCCACTCTGTTCAGG + Intergenic
984931584 4:184852496-184852518 CCTGAGCCTGCACCCTCTTAGGG - Intergenic
985381969 4:189404468-189404490 CCTGAGGCTGCACCCAGTTGCGG - Intergenic
985566945 5:623700-623722 CCTGAGGGTGCCCTGTGTGCTGG + Intronic
986258109 5:6118728-6118750 CCTTTGGCTGGACTCTCTTCCGG + Intergenic
986715337 5:10519661-10519683 CCTGAGGCTGGAGACTGTCCTGG + Intronic
988901995 5:35743843-35743865 GCTGAGCATGCACTATGTTCTGG + Intronic
989586087 5:43074829-43074851 CCTGAGCCTACCCTCTGTTATGG - Intronic
990216688 5:53540779-53540801 CTTGCTGCTGCACTCTGTTTGGG - Intergenic
991259772 5:64654059-64654081 CTTGAGGCTGCATTCAGTTAGGG - Intergenic
993409386 5:87554892-87554914 CCTGAGGCTGCACACAGACCAGG + Intergenic
995676577 5:114669255-114669277 CCTGAGGCAGCACAGTGTTTGGG - Intergenic
997412450 5:133700594-133700616 CCTGGGGCTGCACTCCATCCCGG - Intergenic
997451876 5:133990203-133990225 CCTGAGGCTGCACTTTCCCCAGG - Intronic
998481469 5:142466675-142466697 ACTCAGGCTGCCCTTTGTTCCGG + Intergenic
998952236 5:147404002-147404024 GCTGAGGCTGCATTCTGCCCGGG - Intronic
999245684 5:150153335-150153357 CCTGAGGCTGCACTTTCTGCTGG + Intronic
999327509 5:150652178-150652200 GCAGGGGCTTCACTCTGTTCTGG - Exonic
1000569514 5:162895045-162895067 ATTGAGGCTGCACTCTCTCCAGG - Intergenic
1001959308 5:175870933-175870955 CCTGTGGCTGGACACTGTGCTGG + Intronic
1005737768 6:28764933-28764955 GCTGAGGCTGCACTCAGCTGGGG - Intergenic
1005920422 6:30396526-30396548 CCTGGGGCTGGACTCTGATAGGG - Intergenic
1005933020 6:30497900-30497922 CTGGAGGCTGTGCTCTGTTCAGG - Intergenic
1007455904 6:41976894-41976916 CTTGAGGCTGCTGTTTGTTCAGG + Intronic
1008664401 6:53701861-53701883 CCAGAGCCTGCCATCTGTTCTGG - Intergenic
1008716536 6:54295825-54295847 CCTGAGGCTCCACTGTCTGCTGG - Intergenic
1016202602 6:141430457-141430479 CCTCAGGCTGCACACAGTACAGG + Intergenic
1016392737 6:143591563-143591585 CCTGAGGCTGCTGTGAGTTCAGG + Intronic
1019365909 7:632711-632733 ACGGAGGCTGCACTCTCTACCGG + Intronic
1021640658 7:22733298-22733320 CCTGGGGCTGCACTCCATCCTGG + Intergenic
1022856556 7:34320767-34320789 CCTGAGGGGGCACTCTATTTGGG - Intergenic
1028985849 7:97007415-97007437 CCAGACGCTGCACATTGTTCGGG + Intronic
1031973303 7:128078804-128078826 CCTGAGCCTGCAAGCTGTTGAGG - Intronic
1034154827 7:148948112-148948134 CTTGGGTCTGCTCTCTGTTCTGG + Intergenic
1035297863 7:157877158-157877180 CCTGGTGCTGCACTCAGATCTGG - Intronic
1035297896 7:157877272-157877294 CCTGGTGCTGCACTCAGATCTGG - Intronic
1035297948 7:157877463-157877485 CCTGGCGCTGCACTCAGATCTGG - Intronic
1036219194 8:6907041-6907063 CATGCGGCTGCACTCTGGCCTGG - Intergenic
1036577267 8:10039856-10039878 CCTTAGGCAGCAGGCTGTTCAGG - Intergenic
1038422840 8:27444409-27444431 TCTGAGTCTGCATTCTGTTCTGG - Intronic
1038583515 8:28770148-28770170 CCTCAGCCGGCACTCGGTTCAGG + Intronic
1042603024 8:70518074-70518096 CATGACACTGCACTCCGTTCTGG - Intergenic
1043629877 8:82317031-82317053 CCTGAGGCTGTTCTGTTTTCCGG + Intergenic
1043855657 8:85262270-85262292 TGTGAGGCTGCACTCCTTTCAGG - Intronic
1045361286 8:101436104-101436126 GCTGAGGCTGCACTCTAGCCTGG - Intergenic
1047540282 8:125758586-125758608 CCTGATTTTGCACTCTGTACAGG - Intergenic
1053303732 9:36969477-36969499 CCTGAGCCTTTACTCTGTGCTGG - Intronic
1056233600 9:84570658-84570680 CCTGAGGCTGTGCTCTCTCCAGG - Intergenic
1056429866 9:86516600-86516622 CCTGAGGTGGCACCCTGTTGGGG - Intergenic
1057676818 9:97142336-97142358 CCTGAGGCTGCACACTGCAGGGG + Intergenic
1062108127 9:134766830-134766852 CCTGGGGCTGCTCTCTGTGGTGG + Intronic
1187214959 X:17267281-17267303 CCCCAGGCTGCACTCTGCTGAGG + Intergenic
1187522934 X:20029269-20029291 GCTGAGGCTGCAGCCAGTTCAGG - Intronic
1187572423 X:20518646-20518668 CCCCCGGCTGCACTTTGTTCAGG + Intergenic
1189400342 X:40662272-40662294 CATGCTGCTGCACTCTGTCCTGG - Intronic
1189421353 X:40861022-40861044 CCTGAGGCCCCACTGTGTCCAGG - Intergenic
1190240555 X:48654840-48654862 CTTGCAGCTGCACTCTCTTCTGG + Intergenic
1194092882 X:89600306-89600328 CCTGAGGCTGCACACTGCAGGGG + Intergenic
1195709613 X:107763587-107763609 CTTCAGGCTGCACTCCTTTCTGG - Intronic
1196057340 X:111369846-111369868 ACTGAGGCAGGACTCTGTTGTGG - Intronic