ID: 930887006

View in Genome Browser
Species Human (GRCh38)
Location 2:56337563-56337585
Sequence GTGGAGCCACAGATGGACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 209}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930887006_930887009 -9 Left 930887006 2:56337563-56337585 CCCAGGTCCATCTGTGGCTCCAC 0: 1
1: 0
2: 1
3: 18
4: 209
Right 930887009 2:56337577-56337599 TGGCTCCACTCATATCTCTCTGG 0: 1
1: 0
2: 1
3: 13
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930887006 Original CRISPR GTGGAGCCACAGATGGACCT GGG (reversed) Intronic
900102892 1:970392-970414 CTGGAACCGCAGCTGGACCTTGG - Exonic
900323695 1:2097128-2097150 TTGGGGCCACAGCTGGCCCTTGG + Intronic
900421089 1:2556264-2556286 GGGGAAACACAGATGGACTTTGG + Intronic
900898074 1:5497721-5497743 GAGGAGGCAGAGTTGGACCTGGG - Intergenic
901836619 1:11927946-11927968 GTGGAGACATTGATGGCCCTTGG - Intergenic
901916473 1:12504286-12504308 GTGAGGCCACAGCTGGAACTGGG - Intronic
902696982 1:18146686-18146708 GTGGAGCCACCGAGGGTCCCGGG + Intronic
903180432 1:21602430-21602452 GGGTGGCCACAGATGGGCCTGGG - Intronic
904313430 1:29644010-29644032 GTGGAGCCACATATGGCCCATGG - Intergenic
904869476 1:33607699-33607721 GTGGAGCCACACATGGTGCCGGG - Intronic
905046836 1:35010885-35010907 GCAGAGCCACGGATGGAGCTGGG + Exonic
905738891 1:40352186-40352208 CTGGGTCCACAGATGGACTTTGG - Intronic
906128357 1:43441421-43441443 GTGAAGTCACAGATGGGCCTTGG + Intronic
909603933 1:77489838-77489860 CTGGAGCCAAAGATTGACATGGG - Intronic
912384276 1:109263556-109263578 GTGGAGCCTCAGAGGGCCCTGGG - Intronic
914392878 1:147237498-147237520 GGGCAGCCACAGCTGTACCTGGG + Intronic
914951161 1:152115556-152115578 GTGGAGACAGAGGTGGAGCTGGG - Intergenic
918057338 1:181033366-181033388 GTGTAGCCACAGCTTGATCTTGG + Intergenic
919861312 1:201740801-201740823 GTGTAACCACAGCTGGCCCTGGG + Intronic
920048941 1:203151733-203151755 GTGGAGTCACAGTTTGAACTCGG + Intronic
921207091 1:212858361-212858383 GTGGGGCCCCAGGAGGACCTCGG + Exonic
922007206 1:221543541-221543563 GTGGAGGTTCAGATAGACCTGGG + Intergenic
1065850068 10:29780407-29780429 GTGGAACCACAAAGGGACCCGGG - Intergenic
1065963223 10:30750969-30750991 CTGGACTCAGAGATGGACCTGGG - Intergenic
1067093916 10:43286051-43286073 AAGGAGCCACAGCTGGCCCTGGG + Intergenic
1067264850 10:44732017-44732039 GTGAAGTCACAGCTGAACCTAGG - Intergenic
1068047405 10:51905261-51905283 CTGGTGCAACAGATGGTCCTGGG + Intronic
1069338677 10:67385244-67385266 CTGGAGCCACAGGAGGCCCTGGG - Intronic
1069871596 10:71536364-71536386 ATGGAGCCAGAGAAGGCCCTGGG + Intronic
1071251322 10:83822804-83822826 GTGCAGCCAGGGATGGCCCTGGG + Intergenic
1071365065 10:84891125-84891147 GAGCAGCCACAGATGGCTCTGGG - Intergenic
1072296037 10:94010243-94010265 TTTGAGCCACAGCTGGAACTGGG + Intronic
1075023420 10:118967400-118967422 GTGGAGCCAAGGGTGGGCCTGGG + Intergenic
1075808939 10:125210326-125210348 GTGCATCCAGAGCTGGACCTGGG + Intergenic
1076469523 10:130708780-130708802 GGGGAGCCACAGATGGGCCTCGG - Intergenic
1076692148 10:132229311-132229333 GGTGGGCCACAGATGGCCCTGGG + Intronic
1077128701 11:958009-958031 GTGGAGCCACGGAGGCAACTCGG - Intronic
1077387422 11:2276826-2276848 GGGGAGCCACAGGGAGACCTGGG - Intergenic
1077952663 11:6977596-6977618 TTGGACCCACAGAGAGACCTAGG + Intronic
1079114058 11:17629353-17629375 GTGGGGGCAGAGGTGGACCTGGG - Intronic
1083700371 11:64473488-64473510 GTGGAGCCACAGAGACACCAGGG - Intergenic
1083808818 11:65090857-65090879 GTGGGACCACAGCTGGGCCTTGG - Intronic
1084549673 11:69833840-69833862 GAGGGGTCACAGGTGGACCTTGG + Intergenic
1084792348 11:71482639-71482661 GTGGAGCCGCACAGGCACCTGGG + Intronic
1084792359 11:71482675-71482697 GTGGAGCCGCACAGGCACCTGGG + Intronic
1084792371 11:71482711-71482733 GTGGAGCCGCACAGGCACCTGGG + Intronic
1086932962 11:92713124-92713146 GTAGACCCAGAGATGGACCCAGG + Intronic
1091094334 11:132804717-132804739 GTGGATCCCAAGCTGGACCTTGG + Intronic
1091274787 11:134342768-134342790 GCGGAGCCGCAGAGGGACCAGGG - Exonic
1092249300 12:6883798-6883820 ACGGAGCCATAGAGGGACCTCGG + Intronic
1096482801 12:51953072-51953094 ATTGACCCACAGATGGATCTGGG + Intronic
1099928573 12:89047552-89047574 GTGGATCAAAAGAAGGACCTGGG - Intergenic
1100275735 12:93070190-93070212 GTGAAGCCACATTTGAACCTGGG + Intergenic
1101521903 12:105491602-105491624 GTGAAAACACAGATGAACCTGGG - Intergenic
1103244144 12:119440738-119440760 ATGGAGCCACAAAGAGACCTTGG + Intronic
1110777887 13:79432046-79432068 GTGCAGCCACAGCTGCACCGGGG - Intergenic
1112858256 13:103797566-103797588 GTGGAGCCACACAGGAATCTCGG - Intergenic
1113961380 13:114128168-114128190 GTGTGGCCACACATGGGCCTTGG - Intronic
1115728493 14:36242726-36242748 GAGGAGCCACAGCTAGAACTTGG - Intergenic
1118156605 14:63248683-63248705 GTGGAGCCACAGAATGAACAAGG + Intronic
1119040760 14:71272225-71272247 GAGGAGCCACAGAAGGAACCTGG - Intergenic
1121263303 14:92582100-92582122 TAGGAGGCACAGATGGGCCTAGG + Intronic
1121310102 14:92931322-92931344 GTGAAGCCACAGACGGAGCCAGG + Exonic
1121463105 14:94097156-94097178 GCGGGGCCACAGATGTACCCAGG + Intronic
1123472914 15:20568241-20568263 GTAGAGCCAGAGGTGGTCCTGGG + Intergenic
1123645091 15:22432112-22432134 GTAGAGCCAGAGGTGGTCCTGGG - Intergenic
1124283720 15:28384526-28384548 GTAGAGCCAGAGGTGGTCCTGGG + Intronic
1124298977 15:28527087-28527109 GTAGAGCCAGAGGTGGTCCTGGG - Intronic
1124959454 15:34383626-34383648 GTGCAGCCAGAGGTGGTCCTGGG - Intronic
1124976080 15:34529847-34529869 GTGCAGCCAGAGGTGGTCCTGGG - Intronic
1128381920 15:67119473-67119495 TGGGAGCCAGAGAGGGACCTGGG + Intronic
1128502320 15:68235242-68235264 GTGTAGTCACAGGTGGACCTGGG + Intronic
1129678349 15:77644309-77644331 GAGGAGCCACAGCTGTACCCGGG + Intronic
1129871974 15:78946256-78946278 GTGGAGACACACAGGGACATGGG - Intronic
1131035570 15:89219778-89219800 GTGGCGCAAAAGTTGGACCTGGG + Exonic
1132761106 16:1509050-1509072 GTGGAGCCACTGATGGGGCTGGG + Intronic
1134103442 16:11469139-11469161 GTGCAGACACAGGTGGGCCTAGG + Intronic
1135425958 16:22335971-22335993 GCTGAGGCACACATGGACCTTGG - Intergenic
1136628217 16:31474473-31474495 GGGGAGCCACAAATGGACACTGG - Intronic
1137385012 16:48033429-48033451 GAGGAGGCACACATGGAACTGGG - Intergenic
1137688284 16:50402072-50402094 GGGGAGACAGGGATGGACCTGGG + Intergenic
1138516811 16:57540650-57540672 GTGGTCCCACACATGTACCTGGG - Intergenic
1138552729 16:57756317-57756339 ATGAAGTCACAGATGGACCAAGG - Intronic
1142025482 16:87810625-87810647 CTGCAGCCCCAGGTGGACCTTGG + Intergenic
1143974518 17:10820163-10820185 GAGGAGTCACTGAAGGACCTTGG - Intergenic
1144785217 17:17827639-17827661 CTGGAGCCCCAGGTGCACCTGGG + Intronic
1147005227 17:37397808-37397830 GTGTAGCAACAGGTGCACCTTGG + Intronic
1147365319 17:39955085-39955107 GTGGAGCTGGAGAGGGACCTGGG + Intergenic
1149434381 17:56620695-56620717 TTGGAGGCACAAATGGGCCTTGG - Intergenic
1151534252 17:74729759-74729781 GTGGAGCCCCAGAAGGAGATGGG - Intronic
1152407432 17:80105638-80105660 GTGCAGCCACACATGGATGTGGG - Intergenic
1156544995 18:37955681-37955703 GGGGAACCACAGAATGACCTTGG - Intergenic
1159226938 18:65551901-65551923 GTGAAGCCACAGCTGGAAATAGG - Intergenic
1160921581 19:1523403-1523425 GTGGAGCAGCAGGTGGACCCTGG - Intergenic
1162116165 19:8430773-8430795 GTGGAGCCGGAGGTGGTCCTGGG - Exonic
1162825329 19:13247842-13247864 GTGCAGCCACAGAGAGACCCTGG - Intronic
1165027038 19:32969659-32969681 GGGCAGCCACAGCTGCACCTGGG + Intronic
1165061914 19:33209024-33209046 GAGGACAGACAGATGGACCTTGG + Intronic
1166041100 19:40203547-40203569 GTGGAGCCACACTTGGACTCAGG - Intronic
1166096187 19:40540932-40540954 GAGCAGCCACAGAAGGACCTGGG - Intronic
1166228293 19:41410894-41410916 GTGGAGGCACAGATAGACGTGGG - Intronic
1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG + Intronic
1167505283 19:49867851-49867873 GTGAAGCCAAAGAAGGACTTAGG - Intronic
1167604535 19:50474909-50474931 CTGGAGCCACAGTGGGACCCTGG + Intronic
1168322575 19:55518683-55518705 TTGGGGCCACACATGGACCATGG - Exonic
925359577 2:3268104-3268126 GTGGGGTCACAGAGGGACCAAGG - Intronic
927098251 2:19764444-19764466 CTGGAGCCCCAGATGGACATGGG + Intergenic
929947058 2:46379750-46379772 GAGAGTCCACAGATGGACCTGGG + Intronic
930887006 2:56337563-56337585 GTGGAGCCACAGATGGACCTGGG - Intronic
931497346 2:62823087-62823109 GTAGACCTAAAGATGGACCTAGG - Intronic
932316140 2:70784629-70784651 GTGGAGTCACAGATGGTGGTTGG - Intronic
932589893 2:73059026-73059048 CTGGAGGCAGAGCTGGACCTTGG - Intronic
935824723 2:106934102-106934124 GTGGAAATACAGATGGACCTTGG - Intergenic
936154039 2:110036803-110036825 GGGAAGCCACAGGTGGCCCTGGG - Intergenic
936190645 2:110334612-110334634 GGGAAGCCACAGGTGGCCCTGGG + Intergenic
936590150 2:113795841-113795863 ATGGAGCCTCAAATGGACCCTGG - Intergenic
936668317 2:114624870-114624892 GTGGAGCAACAGATGAACCAAGG - Intronic
936920332 2:117682125-117682147 GTGATTCCACAGATGGATCTGGG + Intergenic
939775178 2:146377488-146377510 GTTGAGTCACAGACGGAGCTGGG - Intergenic
940737537 2:157470508-157470530 GTGGAGTAAGAGATGGACCCTGG - Intronic
944110347 2:196125004-196125026 GTTGAGCCACAGCTGGAGATTGG + Intergenic
947775285 2:232703972-232703994 TTGGAGCCACATATGAACTTAGG + Intronic
1171044711 20:21798906-21798928 GTGGAGAAACACATGAACCTGGG + Intergenic
1172054754 20:32146456-32146478 GTGGAGCCACAGGCAGCCCTTGG + Intronic
1173220887 20:41132179-41132201 TTGGAGCCACAGATAGATTTGGG + Intergenic
1173306495 20:41855671-41855693 GTGGAGCCACATAGCCACCTGGG + Intergenic
1173314542 20:41931441-41931463 TTTGAGCCACAGCTGGAGCTGGG + Intergenic
1173518066 20:43679076-43679098 GTGGTGCCAGAGATGGACTGGGG + Intronic
1173556284 20:43968341-43968363 AAGGTGGCACAGATGGACCTGGG + Intronic
1173970538 20:47148876-47148898 GTCGAGTCAGAGCTGGACCTAGG + Intronic
1175510164 20:59518661-59518683 GTGAGGCCACGGATGAACCTTGG + Intergenic
1176130636 20:63495302-63495324 GTGGAGCCAGGGCTGAACCTCGG - Intronic
1176136233 20:63523201-63523223 GGGGAGCCTCCGATGGACCCAGG + Intergenic
1179110849 21:38443843-38443865 CTGGAGTTACAGAAGGACCTGGG - Intronic
1179639058 21:42735238-42735260 GTGGAGCCTCCGGGGGACCTAGG - Intronic
1180207381 21:46269600-46269622 CTGGAGCCACAGATCAACCAAGG + Intronic
1181996120 22:26884091-26884113 GAGGGCCCACAGACGGACCTAGG + Intergenic
1183945790 22:41325041-41325063 GAGGAGCCACACTTGGGCCTAGG - Intronic
1184981122 22:48096713-48096735 CTGGAGTCGCGGATGGACCTGGG - Intergenic
950429760 3:12944026-12944048 GCAGAGCCACAGAGGGCCCTGGG - Intronic
952931949 3:38367329-38367351 GTGGAGCCAGGAATGAACCTGGG - Intronic
954273851 3:49529773-49529795 AAGGAGCCACAGATGGGGCTGGG + Intronic
957414963 3:79890010-79890032 CTGGGGCCACATATGAACCTAGG + Intergenic
959689910 3:109187628-109187650 GGGGAGTCACTGATGGCCCTAGG - Intergenic
960269193 3:115656087-115656109 GTAGAGCCCCAGATAGAGCTGGG - Intronic
960485796 3:118251450-118251472 TTGGAGCCACAGATGGGACTGGG - Intergenic
961366254 3:126401802-126401824 TGGGAGCCACAGAAGGACCAGGG - Intronic
962830187 3:139132557-139132579 GTGGGCCCACAGATGGCCCCTGG + Intronic
962873478 3:139518349-139518371 GTTGAGGTCCAGATGGACCTTGG - Intronic
964655189 3:159059047-159059069 GTGGAGCCACAGTGGAGCCTGGG - Intronic
965962449 3:174444270-174444292 GTGGGGGCACAGATGGAGGTGGG + Intronic
966512655 3:180781537-180781559 GTGCAGCCACACATGAACCCTGG + Intronic
967111892 3:186301237-186301259 GAGGACCAACAGATGGACATGGG - Intronic
968921653 4:3525270-3525292 GGGGAGCCCCCGATGGACTTGGG - Intronic
968971919 4:3800322-3800344 GTGGAGCCCCATATGGAAATGGG + Intergenic
969211120 4:5687979-5688001 ATGCAGCCTCAGATGGACCTGGG - Intronic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
971198177 4:24488964-24488986 GTGCATCCAGAGATGGGCCTGGG - Intergenic
976000799 4:80371166-80371188 TTTGAGCCACAGCTGGAGCTGGG + Intronic
978787968 4:112630954-112630976 GAGGAGCCACATATGAACCTAGG - Intronic
979440015 4:120740534-120740556 GAGGAGTCACAGATGAATCTAGG - Intronic
980362869 4:131763293-131763315 ATGGAGCCACAGATCGACGCAGG + Intergenic
986150123 5:5120610-5120632 GTGGGGCCCCACATGGGCCTTGG - Intergenic
986371075 5:7080764-7080786 GTGGATCCACAGAAGCACCCAGG - Intergenic
990524219 5:56608642-56608664 GTGGAGTCACAGAGCAACCTTGG - Intergenic
991622050 5:68555254-68555276 ATGGAGGCAGAGATGTACCTTGG - Intergenic
991632273 5:68668027-68668049 ATGGAACCACAGATGGAGTTAGG - Intergenic
993423222 5:87728903-87728925 GTGGAGTCAAAGATGGATATAGG + Intergenic
994328073 5:98472393-98472415 GAGGACCCAGAGATGGACCTAGG + Intergenic
997871977 5:137514328-137514350 GTGAATTCAGAGATGGACCTGGG - Intronic
999128757 5:149266587-149266609 CTGCAGCCACAGATGAAGCTAGG + Intergenic
999380049 5:151114771-151114793 GTGGGGCCACAGTTGGAAATTGG + Intronic
1001941614 5:175743676-175743698 GTGAAGCCAAACATGGGCCTCGG + Intergenic
1002105531 5:176877827-176877849 TTGAAGCCACAGCTGGCCCTAGG + Intronic
1002412735 5:179096281-179096303 TTTGAGTCCCAGATGGACCTGGG + Intergenic
1003232953 6:4271386-4271408 TTAGGGCCACAGAGGGACCTTGG + Intergenic
1004564588 6:16784201-16784223 GTGGAGACACAGATACACATAGG + Intergenic
1005364234 6:25061331-25061353 GTGGAGAGCCAGAAGGACCTGGG + Intergenic
1006083763 6:31582022-31582044 GCGGAGAAACAGATGTACCTCGG + Intronic
1007577602 6:42936040-42936062 GTGGACCCAGAGATGGGACTGGG - Intronic
1014505371 6:122248177-122248199 GTGGACCCACAGGTGCCCCTTGG - Intergenic
1015228483 6:130886046-130886068 GAGGAGCTACAGATGGACAGAGG - Intronic
1015714748 6:136180917-136180939 GTGGAGCTACAGAAGGAGCCAGG + Intronic
1017189566 6:151637814-151637836 GTGGAGGCAAAGATGGTCATTGG - Intergenic
1017477827 6:154816202-154816224 GTGGAGACACAGCTGGACTTAGG + Intronic
1017818744 6:158033688-158033710 TTGGTGCCACAGATGGGCCTGGG - Intronic
1018740238 6:166722949-166722971 GTGTAGGCACAGACAGACCTTGG - Intronic
1021329835 7:19322814-19322836 GTGACATCACAGATGGACCTTGG + Intergenic
1021545625 7:21810394-21810416 ATGGAGACAAAGATGGACATGGG + Intronic
1022488384 7:30797978-30798000 CTGGAGGCACTGAAGGACCTGGG + Intronic
1023789046 7:43737511-43737533 GGGCAGCCACAGCTGCACCTGGG - Intergenic
1024466098 7:49712510-49712532 CTGGAGGGACAGATGCACCTGGG - Intergenic
1025904381 7:65772101-65772123 GTGGGGCCACAGGTGGACACAGG - Intergenic
1027395317 7:77747481-77747503 TTTGAGCCACAGCTGGAGCTGGG - Intronic
1032522433 7:132555989-132556011 ATGGAGCCACAGAGGGCTCTAGG - Intronic
1033194080 7:139311902-139311924 GTGGAGACAGAGCTGGATCTTGG - Intergenic
1033657512 7:143383144-143383166 CTGGAGCCCCAGGTGGATCTGGG + Exonic
1034969785 7:155411640-155411662 CTGGAGCCACAGAGCGACCAAGG + Intergenic
1035038182 7:155908784-155908806 GGGCTGCCACAGAGGGACCTGGG + Intergenic
1035226944 7:157438892-157438914 GAGGAGCCACTGCTGAACCTGGG - Intergenic
1035355451 7:158273751-158273773 GGGGAGCCACAGACAGACATGGG + Intronic
1035461341 7:159041040-159041062 GTGGGGCCCCACATGCACCTGGG + Intronic
1036115524 8:5956210-5956232 GTGATTCCACTGATGGACCTGGG + Intergenic
1036492087 8:9237143-9237165 GTGGAGCCCAAGAGGGACATTGG + Intergenic
1037753663 8:21698123-21698145 CTGGAGCCACAGATGCCTCTAGG - Intronic
1039395610 8:37222818-37222840 CTAGAGCCAGAAATGGACCTTGG + Intergenic
1039904069 8:41773415-41773437 GGGGAGGCACAGCTGAACCTAGG + Intronic
1044122489 8:88414790-88414812 GAGGAATCACAGATGAACCTTGG + Intergenic
1047454964 8:124999905-124999927 GTTGAGCCTCAGATGGAGGTTGG + Intronic
1047509992 8:125508728-125508750 GTGAGGCCCCAGAGGGACCTGGG - Intergenic
1048329968 8:133464687-133464709 GTGGAGGCACAGCAGGACCACGG + Intronic
1048740384 8:137552017-137552039 GTGGAGCCACAGGTGAATCCAGG - Intergenic
1049339287 8:142103377-142103399 GTGCAGGCACAGGTGGACCTAGG - Intergenic
1050212940 9:3284636-3284658 GTGGAGGGGCAAATGGACCTAGG - Intronic
1050935170 9:11386959-11386981 TTTGAGCCACAGCTGGAACTGGG - Intergenic
1052055852 9:23906681-23906703 ATGAAGCCACAGCTGGTCCTGGG - Intergenic
1052523172 9:29577339-29577361 GTGGAACAAGAGATGGAACTAGG - Intergenic
1057130549 9:92651465-92651487 GTGATGCCACAGAAGGCCCTTGG + Intronic
1057516752 9:95728806-95728828 GTGGAGGTACAGAACGACCTGGG + Intergenic
1059404577 9:114092050-114092072 GTTGGGACCCAGATGGACCTGGG - Intronic
1060533650 9:124365294-124365316 AAGGAGCCACAGATGGACACGGG + Intronic
1060976384 9:127767594-127767616 GTGGAGCCTGAGAGGGCCCTCGG + Intronic
1187280780 X:17857305-17857327 CTGGAGCCACCGAGGGAGCTGGG - Intronic
1188002571 X:24995992-24996014 GTGGAGGCACAGAGGAAGCTGGG - Exonic
1188382908 X:29519404-29519426 TTGGAGCTACAGATTGTCCTGGG - Intronic
1190596069 X:52053535-52053557 GGGGAGCCCCAGGTTGACCTGGG + Intronic
1190612755 X:52200538-52200560 GGGGAGCCCCAGGTTGACCTGGG - Intronic
1200089069 X:153625947-153625969 GTGGCTCCACAGTTGGCCCTGGG - Intergenic
1200119957 X:153785516-153785538 GTGGAGCCACAGCCGGGCCTAGG - Exonic