ID: 930887352

View in Genome Browser
Species Human (GRCh38)
Location 2:56341258-56341280
Sequence CACTTCCCCAGTAAGATCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 5, 3: 50, 4: 295}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930887352_930887355 12 Left 930887352 2:56341258-56341280 CCAGAGATCTTACTGGGGAAGTG 0: 1
1: 0
2: 5
3: 50
4: 295
Right 930887355 2:56341293-56341315 ACCAGGTTTTTTCTATCTATTGG 0: 1
1: 1
2: 29
3: 145
4: 341
930887352_930887354 -5 Left 930887352 2:56341258-56341280 CCAGAGATCTTACTGGGGAAGTG 0: 1
1: 0
2: 5
3: 50
4: 295
Right 930887354 2:56341276-56341298 AAGTGGTAATCAACAGTACCAGG 0: 1
1: 0
2: 0
3: 6
4: 116
930887352_930887357 13 Left 930887352 2:56341258-56341280 CCAGAGATCTTACTGGGGAAGTG 0: 1
1: 0
2: 5
3: 50
4: 295
Right 930887357 2:56341294-56341316 CCAGGTTTTTTCTATCTATTGGG 0: 2
1: 20
2: 131
3: 207
4: 405

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930887352 Original CRISPR CACTTCCCCAGTAAGATCTC TGG (reversed) Intronic
902316817 1:15626789-15626811 CAGTTCCCAAGTAAGACATCTGG + Exonic
903147590 1:21385025-21385047 CCACTCCCCAATAAGATCTCAGG - Intergenic
903309637 1:22444501-22444523 CAGCTTCCCAATAAGATCTCAGG + Intergenic
905051375 1:35053892-35053914 CAGCTTCCCAATAAGATCTCAGG + Intergenic
905284303 1:36869294-36869316 CACTTCCCCACGCATATCTCGGG - Intronic
905974681 1:42165731-42165753 CAATTCCCCAGTGAGATCCGCGG - Intergenic
906831408 1:49035575-49035597 CAGCTTTCCAGTAAGATCTCAGG - Intronic
907171332 1:52468401-52468423 CCCTTCCCCAGTAACATTTATGG - Intronic
909099829 1:71336631-71336653 CAGCTTCCCAATAAGATCTCAGG - Intergenic
909436843 1:75651983-75652005 CAGCTTCCCAGTGAGATCTCAGG + Intergenic
909684350 1:78329653-78329675 CAGCTTCCCTGTAAGATCTCAGG - Intronic
910204655 1:84736846-84736868 TAATTCCTCAGTAAGAGCTCAGG - Intergenic
910365452 1:86460291-86460313 CAGCTTCCCAGTAAGATCTCAGG - Intergenic
911485661 1:98501741-98501763 CAGCTTCCCAATAAGATCTCAGG + Intergenic
911490263 1:98556224-98556246 CATTTCCCCAGAAAGTTCACTGG - Intergenic
911854423 1:102858946-102858968 CAGTTTCCCAGTAAGAGCTCAGG + Intergenic
912048768 1:105495561-105495583 CGCTTCTCCAGCAAGGTCTCAGG + Intergenic
912187204 1:107292573-107292595 CACTTTCCCAATAAGATCTCGGG + Intronic
912505811 1:110155111-110155133 AACTTCCCCACTGAGATCTCAGG - Intronic
912549623 1:110476659-110476681 CAGCTTCCCAATAAGATCTCAGG - Intergenic
912627026 1:111213850-111213872 CAGCTTCCCAATAAGATCTCAGG - Intronic
912940153 1:114037584-114037606 CAGCTTCCCAATAAGATCTCGGG - Intergenic
913505071 1:119509444-119509466 CTCTTCCCCAGTGAGTTCCCAGG - Intronic
916013249 1:160725695-160725717 CAGTTTCCCATTAAGATCTCAGG + Intergenic
916036311 1:160925671-160925693 CAGCTTCCCAATAAGATCTCAGG + Intergenic
917800323 1:178563691-178563713 CTCTTCCCCAGTGAAATCTGCGG - Intergenic
918818273 1:189220280-189220302 CAGCTTCCCAATAAGATCTCAGG - Intergenic
919124809 1:193381123-193381145 TCCTTCCCCAGGAAGACCTCTGG - Intergenic
919720090 1:200824569-200824591 CCCTTCCACAGTGAGAACTCAGG + Intronic
920203579 1:204275638-204275660 CAGTTCCCCAGGAGGCTCTCAGG + Intronic
920798114 1:209160225-209160247 CAGCTTCCCAGTACGATCTCAGG - Intergenic
922224234 1:223631439-223631461 CACCTCCCCAGCAAGTTCTAAGG + Intronic
924466473 1:244303286-244303308 CAGCTTCCCAGTAAGATCTCAGG + Intergenic
924809197 1:247386384-247386406 CAGATCCCCTGAAAGATCTCAGG - Intergenic
1063775453 10:9258568-9258590 CACTTCTCCAGGAAGCCCTCTGG + Intergenic
1063777596 10:9281724-9281746 GCCTTCCCAACTAAGATCTCAGG - Intergenic
1064775919 10:18777272-18777294 CAGGTTCCCAGTAAGATCTAAGG + Intergenic
1065265530 10:23971316-23971338 CAGCTTCCCAATAAGATCTCAGG - Intronic
1065534907 10:26707292-26707314 CAGCTTCCCAATAAGATCTCGGG - Intronic
1066084472 10:31962903-31962925 CAGATTCCCAATAAGATCTCAGG - Intergenic
1066289369 10:33999739-33999761 CAGCTTCCCAATAAGATCTCAGG - Intergenic
1067758833 10:49027539-49027561 CACTGCCACAGTCAGGTCTCAGG + Intronic
1068192030 10:53665033-53665055 CATCTTCCCAATAAGATCTCAGG - Intergenic
1068438394 10:57019728-57019750 TAGTTTCCCAGTAAGATTTCAGG + Intergenic
1068665874 10:59675566-59675588 CAGCTTCCCAATAAGATCTCAGG + Intronic
1069107237 10:64397780-64397802 CAATTTCCCAATAAGATCTCAGG - Intergenic
1069330241 10:67283337-67283359 CAGCTTCCCAATAAGATCTCAGG + Intronic
1070054123 10:72918225-72918247 CACTTCAACTGTAAGATCACTGG + Intronic
1070571883 10:77646196-77646218 CAGCTTCCCAATAAGATCTCAGG - Intergenic
1070847349 10:79534159-79534181 CAGCTTCCCAATAAGATCTCAGG - Intergenic
1071409393 10:85373963-85373985 CAGCTTCCCAGTAAGATTTCAGG + Intergenic
1071828971 10:89353223-89353245 CACCTTCCAAGTAAGATCTCAGG + Intronic
1073117628 10:101100602-101100624 CCATTCCCCACTAAGATCCCAGG + Intronic
1073461472 10:103668080-103668102 CAGCTCCCCAGTGAGATCACTGG + Intronic
1073622781 10:105066321-105066343 CTGTTTCCCAGTAAGATCACAGG - Intronic
1073748685 10:106499356-106499378 CAGCTTCCCAATAAGATCTCAGG + Intergenic
1074033550 10:109714152-109714174 CAGCTTCCCAATAAGATCTCAGG + Intergenic
1074537933 10:114342107-114342129 CAGCTTCCCAATAAGATCTCAGG - Intronic
1074735644 10:116429844-116429866 CACTTCCTCATTAAGAAATCAGG + Intronic
1075240204 10:120771552-120771574 CAGTTTCCCGATAAGATCTCAGG + Intergenic
1076388446 10:130076466-130076488 CAGTGACCCAGTAAGATCTGAGG + Intergenic
1076429817 10:130393904-130393926 CAGCTTCCCAGTAAGATCTCAGG + Intergenic
1077680313 11:4233893-4233915 CCCTTCCTCAGTAAGAACTTAGG + Intergenic
1077684591 11:4279313-4279335 CCCTTCCTCAGTAAGAACTTAGG + Intergenic
1077685451 11:4287456-4287478 CCCTTCCTCAGTAAGAACTTAGG - Intergenic
1077689723 11:4330470-4330492 CCCTTCCTCAGTAAGAACTTAGG + Intergenic
1077690602 11:4338617-4338639 CCCTTCCTCAGTAAGAACTTAGG - Intergenic
1078087950 11:8245606-8245628 TACTTCCCCAGTGAGATCCTGGG - Intronic
1079651454 11:22934973-22934995 CACTTCCCCATTTAGATATATGG - Intergenic
1080967885 11:37234728-37234750 CAGCTTCCCAATAAGATCTCAGG - Intergenic
1081189259 11:40082444-40082466 CACTTACTCAGTAAAATCTATGG - Intergenic
1083986069 11:66216335-66216357 CTCTTGCCCAGGAACATCTCAGG - Intronic
1084013844 11:66367435-66367457 CACCTCCCCAGGAGGGTCTCAGG + Intronic
1085963931 11:81498048-81498070 CAGCTTCCCAATAAGATCTCAGG + Intergenic
1086009196 11:82078409-82078431 GAACTTCCCAGTAAGATCTCAGG + Intergenic
1086558871 11:88144398-88144420 CACCTCTCCAGGAAGAACTCAGG - Intronic
1089335883 11:117723757-117723779 CAGTTCCCCAGAGAGATCGCTGG + Intronic
1089782555 11:120883815-120883837 AACTTCCCCAGACTGATCTCAGG - Intronic
1090552334 11:127836410-127836432 CTCTTCCACAGTAAGAACTCTGG - Intergenic
1092209880 12:6639261-6639283 CACTTTCCCAGTAAGCTGACTGG - Intronic
1093489568 12:19689305-19689327 CAGCTTCCCAGTAAGATCTCAGG - Intronic
1094062637 12:26331308-26331330 CAGCTTCCCAGTAAGATCTCAGG + Intergenic
1094192047 12:27707963-27707985 CAACTTTCCAGTAAGATCTCAGG + Intergenic
1094626330 12:32127876-32127898 CACAGCCCCAATAAGATTTCTGG - Intronic
1095102259 12:38197397-38197419 CCTTTCCCCAGTAAGAGATCAGG - Intergenic
1097134197 12:56837749-56837771 CAGCTTCCCAATAAGATCTCAGG - Intergenic
1098733116 12:74064232-74064254 TCCTTCCCCAGGAAGACCTCTGG + Intergenic
1100291951 12:93224097-93224119 CAGCTTCCCAATAAGATCTCAGG - Intergenic
1101219898 12:102627781-102627803 CAGTTTCCCAATAAGATCTCAGG + Intergenic
1103093681 12:118116116-118116138 CAGCTTCCCAGTAAGATCTCAGG - Intronic
1103161455 12:118732755-118732777 CAGCTTCCCAGGAAGATCTCAGG + Intergenic
1103876640 12:124132638-124132660 GACTTCCCCAGGTAGGTCTCAGG - Intronic
1104284489 12:127412310-127412332 CAGCTTCCCAGTGAGATCTCAGG - Intergenic
1105405857 13:20132096-20132118 CAGCTTCCCAGTAAGCTCTCAGG - Intergenic
1107122865 13:36814352-36814374 CAGCTTCCCAATAAGATCTCAGG + Intergenic
1107159614 13:37210938-37210960 CTCTTGCCCAGTCAGATCTGTGG + Intergenic
1109333825 13:60966754-60966776 CAGCTCCCCAGTAAGATCTCAGG + Intergenic
1109514589 13:63425168-63425190 CAGCCTCCCAGTAAGATCTCAGG + Intergenic
1109515422 13:63437617-63437639 CAGTTTGCCAGTAAGATGTCAGG - Intergenic
1109866716 13:68273513-68273535 TAATTTCCCAATAAGATCTCAGG - Intergenic
1111150794 13:84251712-84251734 CAGCTTCCCAGTAAGATCTCAGG + Intergenic
1111243276 13:85503436-85503458 CAGTTTCCCTATAAGATCTCAGG - Intergenic
1112247536 13:97748201-97748223 CAGTTTCCCAATAATATCTCAGG + Intergenic
1112436233 13:99393095-99393117 CACTTCCCTAGCAATTTCTCTGG + Intergenic
1115857849 14:37650256-37650278 CACTCACCCAGTGAGATCTTGGG - Intronic
1115887857 14:37993889-37993911 CAGCTTCCCAATAAGATCTCAGG + Intronic
1116173266 14:41430195-41430217 CACTTTCCAGATAAGATCTCAGG + Intergenic
1116522729 14:45869944-45869966 CAGCTTCCCAATAAGATCTCAGG - Intergenic
1116697357 14:48193927-48193949 CAGCTTCCCAATAAGATCTCAGG + Intergenic
1116916894 14:50533290-50533312 CACTTCCTCAGTATGTGCTCTGG + Intronic
1117099769 14:52334304-52334326 CACCTTCCCAATAAGATCTTGGG - Intergenic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1118161438 14:63294548-63294570 CACATCCACAGTAAGAAATCCGG + Intergenic
1119573818 14:75700329-75700351 CCATTTCCCAGTAAGATCTCAGG + Intronic
1119609661 14:76051082-76051104 CAGTTCATCAGTAAGATGTCTGG - Intronic
1120208600 14:81612431-81612453 CAGCTTCCCAATAAGATCTCAGG + Intergenic
1120491196 14:85180530-85180552 CAGCTTCCCAGTAAGATCGCAGG + Intergenic
1121652979 14:95573643-95573665 CAGCTTCCCAGTAAGATCTCAGG - Intergenic
1121815072 14:96923014-96923036 CAGCTTCCCAGTAAGATCTCAGG + Intronic
1124821582 15:33051576-33051598 CAGCTTCCTAGTAAGATCTCAGG + Intronic
1131418824 15:92286121-92286143 CACTTCAACCGTAAGATCACTGG - Intergenic
1132716256 16:1291560-1291582 CAGCTTCCCGGTAAGATCTCAGG - Intergenic
1133246832 16:4454748-4454770 CACTTCCACAGTCACATCCCAGG - Intronic
1134256816 16:12619169-12619191 CAGCTTACCAGTAAGATCTCAGG + Intergenic
1137746244 16:50822314-50822336 CAGCTTCCCAATAAGATCTCAGG - Intergenic
1138374699 16:56554764-56554786 CACTTCCCCTGTAGGGCCTCAGG + Intergenic
1138522928 16:57581936-57581958 CAGCTTCCCAGTAAGATCTCCGG - Intronic
1138743242 16:59334508-59334530 CAGCTTCCCAGTAAGATCTCAGG - Intergenic
1140459793 16:75130564-75130586 CAGCTTCCCAATAAGATCTCAGG - Intergenic
1140617423 16:76683112-76683134 CACAACCCCAATAAAATCTCTGG - Intergenic
1144300467 17:13919069-13919091 CAGCTTCCCAATAAGATCTCAGG + Intergenic
1144739912 17:17576098-17576120 CACTCCCCCAGCAGGATCCCCGG + Intronic
1145851679 17:28105065-28105087 CAATTCCTCAGTAAGATTCCAGG + Intronic
1146823381 17:36002336-36002358 CAGTTTCCCATTAAGATCTCAGG - Intergenic
1147244144 17:39109458-39109480 CCCTTCCCCACTCAGATTTCTGG + Intronic
1148539803 17:48471395-48471417 CACTTCCTGAGCAAGATGTCAGG + Intergenic
1148599204 17:48881306-48881328 CCCTTCACCTGTAAGATGTCGGG - Intergenic
1149287100 17:55176943-55176965 CACCTCCCCACTTAGTTCTCAGG + Intergenic
1150207615 17:63420772-63420794 CAGTTCCCCAGCAAGGGCTCAGG + Exonic
1153101544 18:1476105-1476127 CAGCTTCCCAATAAGATCTCAGG - Intergenic
1153745769 18:8178071-8178093 CAGCTTCCCAATAAGATCTCAGG - Intronic
1158514360 18:58119117-58119139 CACTTCACCTCTAAGCTCTCAGG + Intronic
1159486806 18:69071640-69071662 CATTTCCTCAGTGAGACCTCTGG + Intergenic
1159539808 18:69760951-69760973 CAGCTTCCCAGTAAGATTTCAGG - Intronic
1159539839 18:69761151-69761173 CAGCTTCCCAGTAAGATTTCAGG - Intronic
1159539853 18:69761251-69761273 CAGCTTCCCAGTAAGATTTCAGG - Intronic
1160247042 18:77167140-77167162 CACTAGCCCAGTAAAATCACAGG - Intergenic
1163571151 19:18083203-18083225 CACTTCCCTAGCATGGTCTCAGG - Intronic
1164086985 19:21911935-21911957 CAACTTCCCAATAAGATCTCAGG - Intergenic
1164087147 19:21913233-21913255 CAGCTTCCCAATAAGATCTCAGG - Intergenic
1164180101 19:22810818-22810840 CAGCTTCCCAATAAGATCTCAGG - Intergenic
1167222857 19:48214401-48214423 CAGCTTCCCAATAAGATCTCGGG + Intronic
1168105629 19:54164326-54164348 TACTTCCTCTCTAAGATCTCTGG + Intronic
925589152 2:5493161-5493183 CACATCGCCAGTAAGTTCTAAGG + Intergenic
925751566 2:7094436-7094458 CAGCTTCCCAATAAGATCTCAGG + Intergenic
926967358 2:18429668-18429690 TAGCTTCCCAGTAAGATCTCAGG + Intergenic
927779586 2:25928669-25928691 AGCTCCCCCAGTCAGATCTCAGG - Exonic
927807185 2:26158603-26158625 CAGCTTCCCAGTAAGATCTCAGG - Intergenic
929356359 2:41029443-41029465 CACTTCCACATTAAGATGTAAGG - Intergenic
930456454 2:51613181-51613203 CCCTTCCCCAAGAAGACCTCTGG - Intergenic
930484870 2:51999055-51999077 CAGTGCCCCAGTAGGAACTCTGG - Intergenic
930887352 2:56341258-56341280 CACTTCCCCAGTAAGATCTCTGG - Intronic
931272788 2:60717462-60717484 CAGCTTCCCAATAAGATCTCAGG - Intergenic
931404430 2:61962612-61962634 TGCAGCCCCAGTAAGATCTCTGG + Intronic
931884982 2:66607474-66607496 CAGCTTCCCAGTAAAATCTCAGG + Intergenic
933833924 2:86231152-86231174 CTCTTCACCAGTAAAATCACTGG + Intronic
934104858 2:88686205-88686227 CAGCTTCCCAATAAGATCTCAGG + Intergenic
934935136 2:98459916-98459938 TGCTGCCCCAGTAAGTTCTCAGG + Intronic
935286475 2:101568091-101568113 CAGCTTCCCAGTAAGATCTCAGG - Intergenic
935328255 2:101957583-101957605 CAGTGCCCCAGTAAAAACTCTGG + Intergenic
937721256 2:125099673-125099695 CAGCTTCCCAATAAGATCTCAGG + Intergenic
939755618 2:146105562-146105584 CAGCTTCCCAATAAGATCTCCGG - Intergenic
939858445 2:147389343-147389365 CAGCTTCCCAATAAGATCTCAGG + Intergenic
940868412 2:158839187-158839209 CAGCTTCCCAATAAGATCTCAGG + Intronic
941685087 2:168440018-168440040 CAGCTTCCCAATAAGATCTCCGG - Intergenic
941717860 2:168782612-168782634 CAGCTTCCCAATAAGATCTCAGG + Intergenic
943706120 2:191036527-191036549 CAGCTTCCCAGTATGATCTCAGG + Intronic
944476612 2:200112918-200112940 CATCTTCCCAATAAGATCTCAGG + Intergenic
944481365 2:200160849-200160871 CAGCTTCCCAATAAGATCTCAGG - Intergenic
944553630 2:200867175-200867197 CAGCTTCCCAATAAGATCTCAGG + Intergenic
947093224 2:226537093-226537115 CACTTCCCCATGACGACCTCAGG + Intergenic
948230662 2:236346819-236346841 CAGCTTCCCAATAAGATCTCAGG + Intronic
1171367008 20:24632101-24632123 CACTTCCACAGAAAGACATCTGG - Intronic
1174013151 20:47467041-47467063 CAGCTTCCCAGTAAGATCTCAGG - Intergenic
1177609151 21:23423347-23423369 CACCTTCCCAATAAGAACTCAGG + Intergenic
1177966078 21:27727350-27727372 CAGCTTCCCAATAAGATCTCAGG - Intergenic
1179254873 21:39706932-39706954 CAGCTCCCCAGTAAGATCTCAGG - Intergenic
1179915484 21:44475287-44475309 CAGCTTCCCAGTAAGACCTCAGG + Intergenic
1180159365 21:45992231-45992253 CACTTCCCCAGGAAGGTGTCAGG - Intronic
1180160086 21:45995250-45995272 CACTTCCCCAGGAAGGTGTCGGG - Intronic
1183024291 22:35052438-35052460 CCCATCCCCAGTCAGTTCTCAGG + Intergenic
949591954 3:5504021-5504043 CACCTTCCCAATAAGATCTCAGG + Intergenic
949676488 3:6460108-6460130 CAGCTTCCCATTAAGATCTCAGG - Intergenic
953194490 3:40719803-40719825 CAGCTTCCCAGTAAGATTTCAGG + Intergenic
953745700 3:45572381-45572403 CAGCTTCCCAGTAAGATCTCAGG + Intronic
955390753 3:58520756-58520778 CACCTCCCCAGGAAGCTGTCAGG + Intronic
955825043 3:62937070-62937092 CAGTTTCCCAGTAAGACCTCAGG - Intergenic
957287437 3:78234857-78234879 CAGCTTCCCAATAAGATCTCAGG - Intergenic
957428892 3:80076275-80076297 CGTGTTCCCAGTAAGATCTCAGG + Intergenic
959834940 3:110906910-110906932 CACTTCCACATTAATATTTCTGG - Intergenic
963036399 3:141033499-141033521 TACTTCCACAGTAAGAACTCTGG + Intergenic
964915675 3:161838547-161838569 CAGTAGCCCAGTAAGATCTCAGG - Intergenic
966218523 3:177527479-177527501 CAGCTTCCCAATAAGATCTCAGG + Intergenic
968373664 4:18924-18946 CACTTCACCAGTGAGAGATCTGG - Intergenic
971689313 4:29812320-29812342 CAGCTTCCCAATAAGATCTCAGG - Intergenic
972241855 4:37201980-37202002 CGGCTTCCCAGTAAGATCTCAGG + Intergenic
972329871 4:38055067-38055089 CAGCTTCCCAATAAGATCTCGGG - Intronic
973573678 4:52265033-52265055 CAGCTTCCCAATAAGATCTCAGG - Intergenic
973702558 4:53551411-53551433 CAGCTTCCTAGTAAGATCTCAGG + Intronic
974098596 4:57392546-57392568 CAGCTTCCCAGTAAGATCTCAGG + Intergenic
974787778 4:66642964-66642986 CACCTCCACAGTCAGATCTCAGG + Intergenic
974882310 4:67774811-67774833 CAGCTTCCCAATAAGATCTCAGG + Intergenic
975703561 4:77089750-77089772 CAGCTTCCCAATAAGATCTCAGG - Intergenic
976201902 4:82587134-82587156 CCTTTCACCAGTCAGATCTCAGG + Intergenic
976276340 4:83282904-83282926 CATTTCCCCAGTTAAACCTCTGG - Intronic
977867715 4:102049774-102049796 CAGCTTCCCAGTAAGATCGCAGG + Intronic
979093971 4:116520571-116520593 CAGCTTCCCAGTAAGATCTCAGG - Intergenic
979919186 4:126477478-126477500 CAGCTTCCCAATAAGATCTCAGG - Intergenic
980259683 4:130432559-130432581 CAGTTTCCTAGTAAGATCTCAGG + Intergenic
980629352 4:135412854-135412876 TCCTTCCCCAAGAAGATCTCTGG + Intergenic
980810767 4:137876108-137876130 CAGCTTCCCAATAAGATCTCAGG - Intergenic
981550008 4:145934537-145934559 CAATTCCCCAGTCTGAGCTCCGG - Intronic
982533028 4:156571569-156571591 CAGCTTCCCAATAAGATCTCAGG - Intergenic
982847579 4:160272890-160272912 TCCTTCCCCAATAAGACCTCTGG + Intergenic
983038735 4:162899051-162899073 CAGCTTCCCAATAAGATCTCAGG - Intergenic
983262982 4:165476532-165476554 CAGCTTCCCAATAAGATCTCAGG - Intronic
983406352 4:167335840-167335862 CAGCTTCCCAATAAGATCTCAGG - Intergenic
983810311 4:172052297-172052319 CACTTCCCAGGGAAGAGCTCGGG + Intronic
983904968 4:173172440-173172462 CAGGTTCCCACTAAGATCTCAGG - Intronic
984436512 4:179717274-179717296 CAGCTTCCCAGTAAGATCCCAGG + Intergenic
985230835 4:187814774-187814796 CAGCTTCCCAGTAAGGTCTCAGG + Intergenic
985461723 4:190113627-190113649 CACTTCACCAGTGAGAGATCTGG + Intergenic
985924662 5:3006449-3006471 CAGCTTCCCAGTAAGATCCCAGG - Intergenic
986275442 5:6271143-6271165 CAACTTCCCAATAAGATCTCAGG - Intergenic
986799469 5:11244812-11244834 CACTTCTCCAGGGAGATCTGTGG - Intronic
987620200 5:20330492-20330514 CAGCTTCCCAATAAGATCTCTGG + Intronic
987681791 5:21145426-21145448 CAGCTTCCCAATAAGATCTCAGG + Intergenic
987924333 5:24320621-24320643 TACTTCCTCAGAAAGATCTGTGG - Intergenic
988228209 5:28442215-28442237 CAGTTTCCCGATAAGATCTCAGG + Intergenic
988650224 5:33140826-33140848 CAGCTTCCCAGTAAGATCTCAGG - Intergenic
988737669 5:34038996-34039018 CAGCTTCCCAATAAGATCTCAGG + Intronic
988853348 5:35200766-35200788 ATCTTCCCCTGTAAGATATCAGG + Intronic
990318088 5:54602796-54602818 CAGCTTCCCAGTAAGACCTCAGG - Intergenic
990444573 5:55882016-55882038 CAGCTCCCCAGTAAGATCTCAGG - Intronic
991030490 5:62077423-62077445 CAGCTTCCTAGTAAGATCTCAGG + Intergenic
992175900 5:74148419-74148441 CACTTCCCCACTTAAATCCCTGG - Intergenic
992588274 5:78264522-78264544 CACATCACCAGTAAAACCTCAGG + Intronic
993364822 5:87022406-87022428 CAGCTCTCCAATAAGATCTCAGG + Intergenic
994223863 5:97229191-97229213 CAGCTTCCCAGTAAGACCTCAGG - Intergenic
994787691 5:104185839-104185861 CAGCTTCCCAGTAAGATCTCAGG + Intergenic
995191372 5:109322230-109322252 CAGCTTCCCAATAAGATCTCAGG + Intergenic
995582120 5:113613266-113613288 CAGCTTCCCAATAAGATCTCAGG - Intergenic
996151107 5:120035981-120036003 CGGCTTCCCAGTAAGATCTCAGG + Intergenic
997210212 5:132072847-132072869 CACTTCCACAGAAAGGCCTCTGG + Intergenic
1003790836 6:9545592-9545614 CACTTACAAAGTAAGATTTCTGG - Intergenic
1004099524 6:12594521-12594543 CAGCTTCCCAGTAAGATCTCAGG - Intergenic
1004200669 6:13544748-13544770 CAGCTTCCCAGTAAGATCTCAGG + Intergenic
1004362910 6:14986843-14986865 CAGCTTCCCAATAAGATCTCAGG - Intergenic
1004474284 6:15956757-15956779 CAGCTTCCCAATAAGATCTCAGG - Intergenic
1005621398 6:27623830-27623852 CAGCTTCCCAGTAAGGTCTCGGG - Intergenic
1005812215 6:29526348-29526370 CAGCTTCCCAATAAGATCTCAGG - Intergenic
1006877846 6:37314165-37314187 CACTTCCCCAGCCACAGCTCTGG + Intronic
1007135405 6:39516558-39516580 CACTTTCCCAGTAATAACTGTGG - Intronic
1009746280 6:67820815-67820837 CACTTTCCTGATAAGATCTCAGG - Intergenic
1011186485 6:84682257-84682279 CAGCTTCCCAATAAGATCTCAGG - Intergenic
1011594963 6:89007510-89007532 CAGATCCCCAGTAAGATCTCAGG + Intergenic
1011685554 6:89820690-89820712 TAGCTTCCCAGTAAGATCTCAGG - Intergenic
1011815391 6:91184051-91184073 CAGCTTCCCAGTAAGATCTCAGG + Intergenic
1012716146 6:102673049-102673071 CAGCTTCCCAATAAGATCTCAGG - Intergenic
1013416015 6:109925293-109925315 CAGCTTCCCAATAAGATCTCAGG + Intergenic
1015119569 6:129686457-129686479 CACTCCACCAGTAAGATATGAGG + Intronic
1016126657 6:140412027-140412049 CAGTTTCCCAATAAGATCTCAGG + Intergenic
1016712921 6:147194020-147194042 CAGCTTCCCAGTAAGATCTCAGG + Intergenic
1019186927 6:170226017-170226039 CCCTGCCCCAGTAAGTTCACTGG + Intergenic
1019817649 7:3212860-3212882 CAGCTTCCCAGTAAGATCCCAGG + Intergenic
1020587345 7:10085517-10085539 CAGTTTCCCAATAAGATCTCAGG - Intergenic
1022110013 7:27223677-27223699 CACCCCCCCAGCAAGATATCTGG - Intergenic
1024423409 7:49197208-49197230 CAGCTTCCCAATAAGATCTCAGG - Intergenic
1024659620 7:51480678-51480700 AACCTCCCCAGAGAGATCTCAGG - Intergenic
1026130486 7:67616666-67616688 CAGCTTCCCAGTAAGACCTCAGG + Intergenic
1027420286 7:78011879-78011901 CAGCTTCCCAATAAGATCTCAGG + Intergenic
1027643445 7:80766748-80766770 CAGCTTCCCAGTAAGATCTCAGG + Intronic
1027993341 7:85392829-85392851 CAGCTTCCCAATAAGATCTCAGG - Intergenic
1028794213 7:94885835-94885857 CAGCTTCCCAATAAGATCTCAGG - Intergenic
1030193053 7:106829214-106829236 CAGCTTCCCAATAAGATCTCAGG + Intergenic
1030675819 7:112384445-112384467 CACTTCCACAGTGAAACCTCTGG + Intergenic
1031268271 7:119610957-119610979 CGCTTCCCCAGTGAGGTTTCAGG + Intergenic
1033446594 7:141428434-141428456 CAGCTTCCCAATAAGATCTCAGG + Intronic
1034000217 7:147403368-147403390 CACATCCTCAGGAAGATCTGAGG - Intronic
1034685571 7:152967939-152967961 CGGCTTCCCAGTAAGATCTCAGG + Intergenic
1034700915 7:153094962-153094984 CCCTTCTCCAGTAAGAAATCTGG - Intergenic
1034731335 7:153389990-153390012 CAGCTTCCCAATAAGATCTCAGG + Intergenic
1034732073 7:153396595-153396617 CAGCTTCCCAATAAGATCTCAGG + Intergenic
1035818494 8:2565982-2566004 CAGCTTCCCAGTAAGATCTCAGG - Intergenic
1036626024 8:10472213-10472235 CAGCTTCCCAGTAAGATCTCAGG - Intergenic
1037132849 8:15427457-15427479 CAGCATCCCAGTAAGATCTCAGG + Intronic
1037135375 8:15453909-15453931 CAGCTTCCCATTAAGATCTCAGG + Intronic
1038314717 8:26474377-26474399 CAGCTTCCCAGTAAGATCTCAGG - Intronic
1038874650 8:31534836-31534858 CAGCTTCCCAATAAGATCTCAGG - Intergenic
1040551132 8:48438555-48438577 CACCTCCCCCGGAAGAGCTCAGG + Intergenic
1041417540 8:57628426-57628448 CTCTTAACCAGCAAGATCTCAGG + Intergenic
1041670154 8:60483532-60483554 CAGCTTCCCAATAAGATCTCAGG + Intergenic
1041720818 8:60973792-60973814 CAGCTTCCCAGTAAGATCTCAGG - Intergenic
1041777501 8:61539545-61539567 CAGCTTCCCAGTAAGGTCTCAGG - Intronic
1042397104 8:68305674-68305696 CAGTTTCCCAATAAGATCTCAGG + Intronic
1042747717 8:72125615-72125637 AAGCTTCCCAGTAAGATCTCAGG + Intergenic
1043005120 8:74809355-74809377 CAACTTCCCAATAAGATCTCAGG + Intronic
1043385900 8:79747649-79747671 CCCTTGCCCAGGAAGATGTCTGG + Intergenic
1043599480 8:81919894-81919916 CAGTTTCCCCATAAGATCTCAGG + Intergenic
1043683273 8:83058244-83058266 CAGCTTCCCAGTAAGATCTTAGG - Intergenic
1043853403 8:85239484-85239506 CAGCTTCCCAGTAGGATCTCAGG + Intronic
1045245919 8:100441616-100441638 GTTTTGCCCAGTAAGATCTCAGG + Intergenic
1046949130 8:120003319-120003341 CATTGACCCAGTAAGACCTCTGG + Intronic
1048372917 8:133795334-133795356 CACTTCCCCAGAATGACCTAAGG + Intergenic
1048545111 8:135379400-135379422 CAATCCACTAGTAAGATCTCTGG - Intergenic
1048639162 8:136333677-136333699 CAGCTTCCCAGTAAGATCTTAGG + Intergenic
1049672550 8:143876400-143876422 CACTTCCCCAGGAAGAGGCCAGG + Intronic
1049821387 8:144635789-144635811 CACTCACCCAGTAGGATCTGAGG + Intergenic
1050301267 9:4261111-4261133 CAGTTCCCCAGTCAGTTTTCTGG - Intronic
1050636606 9:7619309-7619331 CAGCTTCCCAATAAGATCTCAGG + Intergenic
1051889983 9:21931511-21931533 CAGCTTCCTAGTAAGATCTCAGG + Intronic
1052160711 9:25255291-25255313 CAGCTTCCCGGTAAGATCTCAGG + Intergenic
1056435232 9:86569489-86569511 CAGCTTCCCAATAAGATCTCAGG - Intergenic
1058146701 9:101420107-101420129 ACCTTGCCCTGTAAGATCTCTGG + Intergenic
1058283743 9:103150531-103150553 CAGTTCCCCAGTAGGGACTCTGG - Intergenic
1058365788 9:104206804-104206826 CAGCTTCCCAATAAGATCTCAGG + Intergenic
1060186952 9:121569209-121569231 CACTTCCCCAGTCTGAGCCCCGG + Intronic
1060537968 9:124406715-124406737 CACTTCCTCAGGAACATCACAGG + Intronic
1185805240 X:3050917-3050939 CAGTTTCCCAATACGATCTCAGG - Intronic
1186057449 X:5665051-5665073 CAACTTCCCAGTAAGTTCTCAGG - Intergenic
1186067257 X:5779095-5779117 CACTTCCCCAGGAACCTCTAGGG - Intergenic
1187387555 X:18862334-18862356 CGGTTTCCCAGTAAGAGCTCAGG + Intergenic
1189683929 X:43544342-43544364 CAGCTTCCCAATAAGATCTCAGG - Intergenic
1190084127 X:47380630-47380652 CAGCTTCCCAATAAGATCTCAGG - Intronic
1193731963 X:85112720-85112742 CATCTTCCCAATAAGATCTCAGG - Intergenic
1193732408 X:85116873-85116895 CAGCTTCCCAATAAGATCTCAGG + Intergenic
1193870247 X:86788251-86788273 CAGCTTCCCAGTGAGATCTCAGG - Intronic
1194018451 X:88656983-88657005 CACTTCCCCAGGAGCTTCTCAGG - Intergenic
1194161975 X:90465060-90465082 CAGCTTCCCAGTAAGATCTCAGG - Intergenic
1194302195 X:92202368-92202390 CAGCTTCCCAATAAGATCTCAGG - Intronic
1195437732 X:104864764-104864786 TCCTTCCCCAGGAAGACCTCTGG + Intronic
1195878618 X:109569261-109569283 CACCTCCCCAGTAACCTCCCTGG - Intergenic
1196223097 X:113135224-113135246 CAGCTTTCCAGTAAGATCTCAGG - Intergenic
1196845377 X:119892970-119892992 CACCTCCACAGCATGATCTCTGG + Intergenic
1197447066 X:126563528-126563550 AACTTCCCCAGCAAAGTCTCAGG - Intergenic
1197466237 X:126807304-126807326 CAGTGCCCCAGTAGGATTTCTGG - Intergenic
1198823483 X:140674148-140674170 CAGCTTCCCAATAAGATCTCAGG + Intergenic
1199082455 X:143591939-143591961 CAGCTTCCCAGTAGGATCTCAGG - Intergenic
1200157859 X:153987064-153987086 CCCTTCTCCAGTTAGGTCTCAGG + Intergenic
1200508256 Y:4042805-4042827 CAGCTTCCCAGTAAGATCTCAGG - Intergenic
1201910067 Y:19124952-19124974 CAACTTCCCAATAAGATCTCAGG - Intergenic