ID: 930887782

View in Genome Browser
Species Human (GRCh38)
Location 2:56347703-56347725
Sequence CAGAGTGAACTGGAGGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 612
Summary {0: 1, 1: 0, 2: 4, 3: 50, 4: 557}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930887782 Original CRISPR CAGAGTGAACTGGAGGAGGG TGG Intronic
900415593 1:2533048-2533070 CGGAGGGGGCTGGAGGAGGGAGG + Intergenic
900653019 1:3740193-3740215 CACAGTGGACTGGCGAAGGGTGG + Intergenic
900716558 1:4148759-4148781 GAGAGTGCACTGCAGGAGAGAGG + Intergenic
900875305 1:5338344-5338366 CAAAATAAACTGGAGGAGAGTGG - Intergenic
901371717 1:8804341-8804363 GATACTGAACTGGAGGTGGGGGG + Intronic
901817039 1:11800286-11800308 CAGTGGGAAGAGGAGGAGGGAGG - Exonic
902368301 1:15991079-15991101 CAGAGGGCCCTGGAAGAGGGAGG + Intergenic
902638779 1:17752815-17752837 CAGAGTGATCATGAGGTGGGAGG + Intergenic
902745277 1:18469744-18469766 TGGAGAGAGCTGGAGGAGGGAGG - Intergenic
902809743 1:18881344-18881366 CAGAATGAACTGGAGGAGTCAGG - Intronic
902835560 1:19044668-19044690 CAGAGGGCTCTGGAGGCGGGTGG + Intergenic
903668706 1:25022912-25022934 CAGAGAGAAGTGGAGGAGGGAGG - Intergenic
904003646 1:27351918-27351940 GAGAGTGAAATGGAGGTGGGCGG + Intronic
904109333 1:28113115-28113137 AATAGAGAACTGGAGGCGGGTGG + Intergenic
904296993 1:29526230-29526252 CAGAATGTACAGGAGGAGAGTGG + Intergenic
904408871 1:30312832-30312854 GAGAGAGAAATGGAGGAGAGGGG - Intergenic
904424860 1:30416673-30416695 CATCATCAACTGGAGGAGGGGGG + Intergenic
904625611 1:31800225-31800247 CAGGGTGGACTGGAGGAGGGAGG - Intronic
904631658 1:31847348-31847370 CAGAGTGGCAGGGAGGAGGGAGG + Intergenic
905534987 1:38714372-38714394 CCCAGTGAAATGGGGGAGGGTGG - Intergenic
906105682 1:43290737-43290759 CTGAGTGAACAGCAGGAAGGGGG + Intergenic
906205157 1:43982584-43982606 CAGAGGGACCTGGAGGATGCAGG + Intronic
906414220 1:45607434-45607456 GACAGTGAAATGGAGAAGGGTGG + Exonic
906717996 1:47984512-47984534 CAAGGTGAACTGGAGGTGGAGGG + Intronic
907505887 1:54918071-54918093 GAGAGAGAGATGGAGGAGGGAGG - Intergenic
909981615 1:82109001-82109023 TAGAATGAACTAGAGGAGTGTGG + Intergenic
910523934 1:88155884-88155906 TAGTGTGAAGTGGAGGATGGAGG - Intergenic
910693835 1:89991695-89991717 CAGAATGGATTGGAGGTGGGAGG + Intergenic
911196468 1:94999964-94999986 AAGAGTGAAATGGAGCAGGAGGG - Intronic
912077778 1:105898270-105898292 TAGAGGAAGCTGGAGGAGGGAGG - Intergenic
912711586 1:111953889-111953911 GAGAGTGATCTGGAGCAGGAGGG - Intronic
912965683 1:114235210-114235232 CAGAGGAAACTGGGGGTGGGTGG + Intergenic
913079212 1:115366151-115366173 CTAAGGGAACTGGAGGAGTGTGG + Intergenic
915129746 1:153688112-153688134 CAGAGTCACCTGGAGGAGTTGGG + Exonic
915144716 1:153789667-153789689 CAGAGCGAGCTCCAGGAGGGCGG - Intergenic
915327089 1:155086155-155086177 CATGGTGAACTGGGGGAGAGTGG - Exonic
915513923 1:156401845-156401867 CAGAGGGAAGGGGAGGAGGTGGG + Intergenic
915579011 1:156802227-156802249 TTGAGTGAACTGAAGGAGGTGGG - Intergenic
915917829 1:159951687-159951709 CAGAATGAAATTGAGGAAGGAGG - Exonic
915918071 1:159953097-159953119 CGGAGTGACCTGGAGCAAGGAGG - Intronic
917527341 1:175800662-175800684 CAGATTTGACTGCAGGAGGGTGG + Intergenic
917849352 1:179047274-179047296 CAGGATGGTCTGGAGGAGGGAGG - Intronic
918107714 1:181427790-181427812 AAGAGGGAAGGGGAGGAGGGAGG - Intronic
918459552 1:184762121-184762143 CAGAATGAATTGGAGTAGGAAGG - Intergenic
918593224 1:186262850-186262872 CAGAGTGAACTGGAAGTGGATGG + Intergenic
919799569 1:201345347-201345369 AAGAGTCAGCTGCAGGAGGGAGG - Intergenic
921455494 1:215365914-215365936 GAGAGTGAGCTGAAGCAGGGCGG - Intergenic
921628364 1:217403324-217403346 GAGAGGGAGCTGGAGGAGCGGGG + Intergenic
922040247 1:221889294-221889316 CAGAGGGAAGTGGAGGAGGTAGG + Intergenic
922314596 1:224432772-224432794 CAGAATGAAATGAAGGGGGGAGG - Intronic
922627366 1:227062245-227062267 CAGAGCGAACTTGCGGGGGGAGG - Intronic
922668229 1:227490665-227490687 CAGAGGGAAGAGGAGGAGGCAGG - Intergenic
923052161 1:230396424-230396446 GAGAGTGAAAGGGAGGATGGTGG - Intronic
923271058 1:232355354-232355376 CACAGTGGTCTGGAGCAGGGAGG + Intergenic
924554077 1:245103722-245103744 GAGAGGGGACCGGAGGAGGGTGG + Intronic
924582372 1:245333503-245333525 CAGAGCGTTCTGGAGGTGGGCGG + Intronic
1063606796 10:7529650-7529672 GAGAGGGAAAGGGAGGAGGGTGG + Intergenic
1063936963 10:11088260-11088282 CAGAGTGAACAGCATGAGTGAGG + Intronic
1064226358 10:13489168-13489190 CAGAGAGAAATGGAGTGGGGAGG + Intronic
1064855797 10:19766171-19766193 CTGAGTGCAGTGGAGGAGTGGGG - Intronic
1065358538 10:24867250-24867272 CAGAGTTAAATGAAGGAGGGAGG - Intronic
1067096108 10:43301371-43301393 CAGAGTGACCTCCAGGAGTGGGG + Intergenic
1067135667 10:43605524-43605546 CAGAGACTAGTGGAGGAGGGGGG + Intergenic
1067767014 10:49094501-49094523 CTGAGGGACCTGGAGCAGGGTGG - Intronic
1068055193 10:52004668-52004690 CAGAGTGACCTGGAAGTGGTAGG + Intronic
1068496125 10:57787137-57787159 CAGAGAGACCTGGAGAAGGTAGG - Intergenic
1068538652 10:58267970-58267992 CTGAGGGGACTGGAGGACGGCGG - Intergenic
1069359175 10:67622415-67622437 CAGAGTGAACTGGGGTTGGTTGG + Intronic
1069835914 10:71308043-71308065 CAGAGTGCACTGGAAGGGGTAGG + Intergenic
1069917273 10:71795489-71795511 GAGAGTCAGCTGGAGGAAGGGGG - Intronic
1070169783 10:73924198-73924220 CTGAGCCAGCTGGAGGAGGGAGG - Intergenic
1070602255 10:77873976-77873998 CAGTGTGAGCTGGAGGAGGGCGG - Intronic
1070829247 10:79408526-79408548 CACAAGGCACTGGAGGAGGGTGG + Intronic
1070887354 10:79915358-79915380 CAGATTCAGCTTGAGGAGGGTGG + Intergenic
1071137408 10:82468208-82468230 CAGCGTGATGTGGTGGAGGGAGG - Intronic
1072549277 10:96465094-96465116 CTCAGGGAACTGGAGGAGAGAGG + Intronic
1072608383 10:97001575-97001597 CAGACTGAACTGCTGGAGGGAGG + Intronic
1075575853 10:123576972-123576994 CAGAGTGAACAGAATGAGAGGGG + Intergenic
1075913592 10:126147357-126147379 CAGAGGGAACAGGAGGGGAGAGG - Intronic
1076064589 10:127439409-127439431 CAGAGAGACCTGGAGGAAGGTGG + Intronic
1076482819 10:130796048-130796070 CAGAGGCCGCTGGAGGAGGGTGG + Intergenic
1076568227 10:131413209-131413231 CAGAGTCAGCTGGTGGAGGCTGG + Intergenic
1076698367 10:132257735-132257757 CAGAGGGGCCTGGTGGAGGGTGG - Intronic
1076820944 10:132939310-132939332 GAGTGTGAAGTGGAGGAGGGTGG + Intronic
1078104298 11:8349076-8349098 CAGAGGGAGCTGGCGGTGGGAGG - Intergenic
1078338402 11:10482049-10482071 CAAAGTGATCTGCAGAAGGGAGG - Exonic
1078361798 11:10675012-10675034 CAGAGTGACCCGGAGCAGGAAGG + Intronic
1078840658 11:15073540-15073562 CAGAGATAGCTGGAGGGGGGGGG - Exonic
1079088665 11:17465207-17465229 CAGAGTGGAGTGGAGGCAGGGGG - Intronic
1081111991 11:39147349-39147371 AAGAGTTAACTGGAGTAGAGTGG + Intergenic
1081232155 11:40598799-40598821 CAGAGGGTGCTGGGGGAGGGAGG + Intronic
1081493043 11:43581695-43581717 CAGGGGGAACTGGAGCAGGTGGG + Intronic
1082867161 11:57910713-57910735 CAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1083663712 11:64263792-64263814 CAGGGTGAGCTGGGGGTGGGCGG + Exonic
1083738084 11:64693166-64693188 CAGGCAGAACTGGAGGAAGGAGG + Intronic
1083791592 11:64989495-64989517 CAGGGGGCACTGGAGGAGGCTGG + Exonic
1083831428 11:65236335-65236357 CAGGGTGTAGTGGAGAAGGGTGG - Intergenic
1084662523 11:70554551-70554573 CAGAGGAACCTGGGGGAGGGGGG - Intronic
1085597178 11:77820712-77820734 CATTTTGAACTGGAGGATGGAGG + Exonic
1086539352 11:87889233-87889255 CAGAGGGAGGTGGAGAAGGGTGG - Intergenic
1087728128 11:101746447-101746469 AAGGGTGAAAAGGAGGAGGGAGG - Intronic
1088332749 11:108670319-108670341 GAGAGGGAACAGGAGTAGGGAGG + Intronic
1089655504 11:119944125-119944147 CAGAGAGCCCTGGAGGAGAGCGG + Intergenic
1089859068 11:121572691-121572713 CAGGGAGCAGTGGAGGAGGGGGG + Intronic
1090150116 11:124375071-124375093 CAGAATGAGCTGGAAGATGGGGG - Intergenic
1090247694 11:125228526-125228548 CGGAGTCACCTGGGGGAGGGAGG + Intronic
1090522186 11:127491096-127491118 CAGTGAGAACTTGAGGTGGGTGG - Intergenic
1091340767 11:134811641-134811663 GAGAGTGAATTGGAGGAGGAGGG + Intergenic
1091415372 12:278267-278289 CAGAGTAAACTGACAGAGGGGGG + Intergenic
1091628356 12:2139810-2139832 CAGTGTGAACTGGAGGTGTAAGG + Intronic
1091673150 12:2467353-2467375 CAGAGTGACCTGGTGGCAGGTGG + Intronic
1091692774 12:2608466-2608488 CAGAGGGAACTGGAGAAGCAGGG - Intronic
1091754685 12:3043741-3043763 CAGAGTGAACAGGAGAGAGGAGG + Intergenic
1092048862 12:5453805-5453827 CTTAGTGAAGGGGAGGAGGGAGG + Intronic
1092387663 12:8048306-8048328 CACAGTGATCTAGAGGAGGGTGG + Intronic
1092428587 12:8392068-8392090 TAGGGAGAGCTGGAGGAGGGAGG - Intergenic
1092429669 12:8398212-8398234 TAGGGAGAGCTGGAGGAGGGAGG - Intergenic
1092821533 12:12357527-12357549 CAGGGCGGGCTGGAGGAGGGTGG - Intronic
1093780142 12:23126058-23126080 CAGAGTCAACAGGAGGAATGTGG - Intergenic
1094191352 12:27701460-27701482 CAGAGTGAGCTGGAGGCGAGAGG + Intergenic
1094311784 12:29092519-29092541 GAGAGTGAGCTGAAGCAGGGTGG + Intergenic
1095812206 12:46383341-46383363 AAGAGAGAAAAGGAGGAGGGAGG + Intergenic
1095969769 12:47893667-47893689 CTGAGTGGACTGGTGGAGGCAGG - Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096638872 12:52978473-52978495 AAGAGTGAACTGGGTGAGGAAGG - Intergenic
1096680238 12:53251176-53251198 AACAGAGAACTGGAGGAGGTGGG + Intergenic
1097190777 12:57218397-57218419 CTTAGTGAACTGGAGGAGTGGGG + Intronic
1097264852 12:57738821-57738843 AAGAGGGAACGGGAGGTGGGTGG + Intronic
1097380989 12:58895516-58895538 CAGAGTGCACGGGTGGAGAGTGG + Intronic
1097737301 12:63196360-63196382 AAGAGTGAACCGAAGCAGGGTGG + Intergenic
1098607062 12:72403857-72403879 CAGAGTGGAGTGGAGGGGGTAGG + Intronic
1099345612 12:81496144-81496166 AAGAGAGAAGCGGAGGAGGGAGG - Intronic
1099512687 12:83556526-83556548 GAGGGTGAGCTGAAGGAGGGTGG - Intergenic
1101865639 12:108517717-108517739 CACAGAGAACTGGTGGAGGTGGG - Intronic
1102007052 12:109595748-109595770 CAGAGGGAAATGGAGGCAGGTGG - Intronic
1102138256 12:110593211-110593233 CTGACTAAACTGGAGGAGGGTGG + Intergenic
1102244814 12:111348535-111348557 CAGGGTGAAGAGGAGCAGGGGGG - Exonic
1103940829 12:124500368-124500390 CAGAGTGCAGTGGGGGCGGGGGG - Intronic
1104040526 12:125127248-125127270 CAGAGTGAGCAGCAGGAAGGAGG + Intronic
1104188595 12:126456331-126456353 CAGAAGGTACTGGAGGAAGGAGG - Intergenic
1104643525 12:130481954-130481976 CACAGTGAACTGGTGGTGGGCGG - Intronic
1104742982 12:131192688-131192710 AGGAGTGAACTGGAAGAGGCTGG - Intergenic
1104958930 12:132479028-132479050 CAGAGTGGACTGTAGGAGGCAGG + Intergenic
1104960969 12:132488641-132488663 CTGGGTGGACTGGAGGAGGCTGG + Intergenic
1105789880 13:23788003-23788025 GGGAGTCAGCTGGAGGAGGGTGG + Intronic
1105900335 13:24747074-24747096 CAGAGTGCGCTGAAGGGGGGCGG - Intergenic
1106537741 13:30662706-30662728 CAGTGTGAACTGAAAGAGGAAGG + Intergenic
1106593388 13:31116937-31116959 CAGAGGGAGAGGGAGGAGGGAGG + Intergenic
1106996442 13:35488818-35488840 CAGAGTGAACTGGTGAATGTAGG + Intronic
1108086364 13:46797246-46797268 GAGACTGAACTGGAGAAGAGCGG - Intergenic
1108515055 13:51193443-51193465 CAGAGTGAAAGGGAGTAGGATGG + Intergenic
1108637086 13:52345842-52345864 CAGAGGCAACTTGAGGTGGGGGG + Intergenic
1109167458 13:59053593-59053615 CAGAGAGACCTGGATGAGAGTGG + Intergenic
1109303046 13:60609224-60609246 GAGATTGTACTGGAGTAGGGTGG - Intergenic
1109726591 13:66349186-66349208 CAGTGTTTCCTGGAGGAGGGAGG + Intronic
1112441368 13:99426971-99426993 GAGAATGAAGGGGAGGAGGGAGG + Intergenic
1112441440 13:99427157-99427179 GAGGGTGAAAGGGAGGAGGGAGG + Intergenic
1112578957 13:100662196-100662218 CAGGGTGAGGTGGAGGAGGGTGG - Intronic
1112578978 13:100662242-100662264 CAGGGTGAGGTGGAGGAGGGTGG + Intronic
1113149466 13:107246054-107246076 CAGAATGAGATAGAGGAGGGTGG - Intronic
1113394457 13:109933719-109933741 CAGGGTGAAGAGGAGGAGTGTGG - Intergenic
1114366662 14:22034294-22034316 CAGTGTGAACAGGAAGAGGCAGG + Intergenic
1114553724 14:23549633-23549655 TAGAATGAACTGAAGGATGGGGG + Intronic
1115135820 14:30107103-30107125 GAGCGTGAACTGAAGCAGGGTGG + Intronic
1115227742 14:31121932-31121954 CAGAGTTAAGTGGAAGAGTGAGG - Intronic
1115379151 14:32714103-32714125 CAGAGAGAACTGCTGGTGGGTGG + Intronic
1115913019 14:38277308-38277330 CAGAGTGCACTGGGGCAGGAGGG - Intergenic
1116452248 14:45080002-45080024 CAGAGTGGAATTGAGGAGTGAGG - Intergenic
1117045183 14:51806343-51806365 TAGAGAGAAATGGAGGAGGATGG - Intergenic
1117715487 14:58575691-58575713 CAGAGGGAAATGGAAGAGAGAGG - Intergenic
1117730592 14:58718325-58718347 CTGACTGAACTGGGGGAGAGAGG - Intergenic
1118348073 14:64954230-64954252 AAGAGTGAAGAGAAGGAGGGAGG + Intronic
1118492407 14:66273883-66273905 GAGAGGGAGCTGGAGGTGGGGGG - Intergenic
1118567549 14:67158418-67158440 GAGAATGAATTGGAGGAGGGTGG + Intronic
1119425695 14:74533506-74533528 TGCAGTGAGCTGGAGGAGGGAGG + Intronic
1120858514 14:89233972-89233994 CAGAGTGACCTGGTGAGGGGAGG - Intronic
1121285146 14:92729336-92729358 CAGAGAGAGCTGGAAGAGTGAGG - Intronic
1121466036 14:94116081-94116103 CTGAGGGAGATGGAGGAGGGAGG + Intronic
1121521799 14:94591009-94591031 TAGAGTGAACTGGAGTGGAGTGG - Intronic
1121521807 14:94591079-94591101 TAGAGTGAACTGGAGTGGAGTGG - Intronic
1121521812 14:94591119-94591141 TAGAGTGAACTGGAGTGGAGTGG - Intronic
1121730803 14:96185717-96185739 CAGAGTGACCTTGGGGAGGCGGG + Intergenic
1122014650 14:98784328-98784350 CAGAGTGGACAGGAAAAGGGAGG + Intergenic
1122941020 14:104981418-104981440 CAGAGTGGGCAGGAGAAGGGAGG - Intergenic
1123756746 15:23402847-23402869 CAGTGTGGACTGGAAGATGGCGG - Intergenic
1124006307 15:25798064-25798086 CCTAGTTAACTGGAAGAGGGAGG + Intronic
1124662370 15:31560765-31560787 CAGGCTGAACTGGAGGACAGTGG - Intronic
1124685666 15:31779768-31779790 GAGAGAGAAATGGAGGAGGTGGG + Intronic
1124720115 15:32104430-32104452 CAGAGTGGGCTGGAGGTGGAGGG - Intronic
1125106165 15:35973993-35974015 CAGATTGAAGTTAAGGAGGGAGG - Intergenic
1125219478 15:37317223-37317245 AAGGGTGAACTGAAGCAGGGTGG + Intergenic
1125273167 15:37962552-37962574 CAGAATGAATTGGGGGATGGGGG + Intronic
1126320675 15:47419454-47419476 GAGAATGAACTGGAGGATGGTGG + Intronic
1126424854 15:48516267-48516289 CAGGGAGAACTGGAGGAATGGGG + Exonic
1127193686 15:56561560-56561582 GAGAGTGAGCTGAAGAAGGGCGG + Intergenic
1127448253 15:59088205-59088227 CAGGGTGAACAGGTGAAGGGAGG + Intronic
1127635950 15:60869822-60869844 CAGAGGGAACAAGAGGAGGATGG - Intronic
1127683170 15:61316953-61316975 CAGAGTGCACTGGAACAGTGTGG + Intergenic
1128027204 15:64448057-64448079 GAGAATGAAATGGAGGAGGAAGG - Intronic
1128261506 15:66236192-66236214 CTGTGTGTTCTGGAGGAGGGAGG + Intronic
1128942511 15:71800182-71800204 CAGGGTGACATGGAGGAGTGAGG - Intronic
1129117818 15:73375047-73375069 CAGAATGGACTGGGAGAGGGGGG + Intergenic
1129411797 15:75354508-75354530 CAGAGTGCAGGGGAGGAGGCGGG - Intronic
1129666043 15:77579919-77579941 CAGTGTGAGCTGGGGGTGGGGGG - Intergenic
1129679365 15:77649552-77649574 GAGAGTGATTTGGAGGAGGAAGG + Intronic
1131565469 15:93481558-93481580 CAGAATAAACTGGGGAAGGGCGG - Intergenic
1132542076 16:514881-514903 CAGAGTGAACTGGGTGAACGTGG + Intronic
1133875011 16:9725819-9725841 CAGAGAGAGATGGAGGTGGGGGG - Intergenic
1133958295 16:10467130-10467152 CAGAGTGAACTAGAGGTAGAAGG - Intronic
1134071851 16:11265169-11265191 CAGGGTGAACAGGTGAAGGGAGG - Intronic
1134384214 16:13756906-13756928 AAGGGTAAACTTGAGGAGGGAGG - Intergenic
1134459594 16:14419915-14419937 CAGCGTGGACTGGAAGATGGCGG + Intergenic
1135686719 16:24503702-24503724 CAGAGATAAATGAAGGAGGGAGG + Intergenic
1135700832 16:24631044-24631066 CAGAATGAATTGGCGCAGGGAGG - Intergenic
1135892128 16:26366668-26366690 CAGAGGGAGAGGGAGGAGGGTGG + Intergenic
1136080987 16:27852530-27852552 CAGAGGGAGGAGGAGGAGGGTGG + Intronic
1136903467 16:34064992-34065014 CAGAGTGAAATGGAGTGGAGTGG + Intergenic
1138248952 16:55487862-55487884 AAGAATGAAGAGGAGGAGGGAGG - Intronic
1138594083 16:58020256-58020278 CAGAGGGCCCTGGAGGAGGAAGG - Exonic
1139546897 16:67653678-67653700 CAGCGGGCACTGGCGGAGGGCGG + Intronic
1140046912 16:71445889-71445911 CAGAGTGACAAGGAGTAGGGAGG - Intergenic
1140341621 16:74170363-74170385 GAGAGTGAACTGGGGGAGACGGG + Intergenic
1140799915 16:78476928-78476950 AAGAGGGAACTGAAGGAGGAAGG - Intronic
1141518136 16:84559886-84559908 GAGAAGCAACTGGAGGAGGGAGG + Intergenic
1141771574 16:86092884-86092906 CACCGGGAACTGGAGGAGGTGGG - Intergenic
1141871464 16:86789343-86789365 GAGAGTGAAGTGGAGTGGGGAGG - Intergenic
1142762064 17:2048592-2048614 CAGAATGAACGGGATGTGGGGGG - Intergenic
1144260774 17:13517982-13518004 CAGAGTCAACTGGGAGAGGAAGG + Intronic
1145392656 17:22467835-22467857 GAGAGAGAACTGAAGAAGGGTGG - Intergenic
1145761112 17:27425887-27425909 CAGAGGGCCCTGGAAGAGGGAGG + Intergenic
1146008905 17:29179269-29179291 CAGAATGAGCTAGAGGTGGGGGG - Intronic
1146161160 17:30560045-30560067 CAGAGGGCCCTGGAAGAGGGAGG + Intronic
1146182588 17:30707639-30707661 TAGAGGGAACAGGGGGAGGGGGG - Intergenic
1146278834 17:31531976-31531998 CAGAGGGTACTGGAAGTGGGAGG + Exonic
1146835667 17:36108652-36108674 GAGAGTGAGCTGGGGGAGGTGGG - Intergenic
1146850299 17:36215922-36215944 GAGAGTGAGCTGGGGGAGGTGGG - Intronic
1147266702 17:39238607-39238629 CAGGGTGAGCTGGAGGTGGTAGG + Intergenic
1147588576 17:41666900-41666922 AAGAGAGAACTTGCGGAGGGGGG - Intergenic
1148546382 17:48522319-48522341 CAGAGCCAACAGGAGGAGGCTGG + Intergenic
1148999170 17:51739478-51739500 CAGAGTCAAGTGGAGGAGGATGG + Intronic
1149187478 17:54016580-54016602 CAGGGAGAACTGGTGGTGGGCGG + Intergenic
1149433140 17:56610512-56610534 CAGTGTGAAATGGAGAAGGAAGG - Intergenic
1149504535 17:57183101-57183123 GAAAGGGAACTGGAGGAGGAGGG + Intergenic
1149515207 17:57275923-57275945 CACAGAGAACTGAAGGAGGGAGG - Intronic
1149620458 17:58041023-58041045 CAGCCTGAACTGAAGGAGAGGGG - Intergenic
1149868083 17:60161665-60161687 CGGAGGGAAAGGGAGGAGGGAGG - Intronic
1150436711 17:65159697-65159719 CCGAATAAACTGGAGCAGGGTGG + Intronic
1150468432 17:65415203-65415225 CACTATGAACTGGAGGAAGGTGG + Intergenic
1151460788 17:74252912-74252934 CAGAATGATCTGCAGGAGGCAGG + Intronic
1152103114 17:78314271-78314293 CAGGGTGAGCGGGAGGAGGGAGG + Intergenic
1152568771 17:81112160-81112182 CAGAGGGACCTGGGGGAGTGGGG - Intronic
1152704307 17:81834814-81834836 CAGGGTGACCTGGAGCAGGTGGG - Exonic
1152837671 17:82544776-82544798 CAGAGTGAAGTGCTGGCGGGTGG + Intronic
1153813319 18:8771008-8771030 ATGAGTGAACAGGAGGAAGGGGG + Intronic
1154233415 18:12579846-12579868 CAGAGTGAAGTGGTAGAGTGAGG - Intronic
1154485034 18:14866456-14866478 CAGCCTGAGCTGTAGGAGGGTGG + Intergenic
1157139531 18:45091882-45091904 CCTAGAGAAGTGGAGGAGGGAGG - Intergenic
1157614711 18:48979604-48979626 CAGAGAGGACTGGAGTTGGGTGG - Intergenic
1157683014 18:49621746-49621768 GAGAGAGAAATGGGGGAGGGAGG + Intergenic
1157804090 18:50645092-50645114 CAGGGAGAACTGGTGGAAGGCGG + Intronic
1157939749 18:51915124-51915146 CAGAGTGGACTGGAGGGAGCAGG + Intergenic
1158427365 18:57352338-57352360 TAGAGGGAAATGGTGGAGGGAGG - Exonic
1159000727 18:62972606-62972628 CATAGTGCACTGGAGAAGGTAGG - Exonic
1159356520 18:67343464-67343486 AAGCAGGAACTGGAGGAGGGAGG + Intergenic
1159917386 18:74199029-74199051 CCGGGTGAACTGCTGGAGGGAGG + Intergenic
1160209102 18:76861327-76861349 CAGTGAGAACGGGAGGAGGAAGG + Intronic
1161289402 19:3485007-3485029 CAGAGTGAGCCGGGGGAGTGGGG + Intergenic
1161585272 19:5102341-5102363 CAGAGGCAACTGCAGGAAGGAGG - Intronic
1161589326 19:5121975-5121997 CAGCGTGGACAGGGGGAGGGAGG - Intronic
1161637938 19:5400992-5401014 CAGATGTAACTGGAGTAGGGTGG + Intergenic
1161644686 19:5445804-5445826 CAGAGGCCACTGGAGGAGGCTGG - Intergenic
1161756428 19:6137456-6137478 CAGAGTGAGGAGGGGGAGGGAGG + Intronic
1162472800 19:10882510-10882532 CAGAGTGCACTGGAGATTGGGGG - Intronic
1163130728 19:15271203-15271225 CAGTGGGAACTGAAGCAGGGAGG - Intronic
1164152429 19:22566448-22566470 GAGAGTGAGCTGAAGCAGGGTGG - Intergenic
1164692795 19:30223411-30223433 AGGAGTGCACTGGAGGAGTGAGG - Intergenic
1166071879 19:40392812-40392834 CAGAGAGACATGGAGGAGGCTGG + Intergenic
1166321441 19:42021678-42021700 CAGAGAGAAATAGAGAAGGGAGG + Intronic
1166627482 19:44372071-44372093 CAGAATGAGCTGTAGGAAGGTGG - Intronic
1167080556 19:47274224-47274246 GAGAGTGTGCTGGAGGAGGCGGG + Intergenic
1167094504 19:47367164-47367186 CTGAGTGATCAGGAGGGGGGTGG - Intronic
1167194764 19:48020687-48020709 CAGAGGGCCCTGGAGGAAGGAGG - Intronic
1167409766 19:49338035-49338057 GGGAGGGAACTGGAGGAGGGGGG - Intronic
1168149678 19:54438879-54438901 CAGAGTGGACTGAAGGAGAGGGG + Intergenic
925416478 2:3673308-3673330 CAGAGAGATCTGGAGCAAGGGGG + Intronic
926085389 2:10016580-10016602 CAGGGTGAGTAGGAGGAGGGAGG + Intergenic
926110680 2:10181533-10181555 CAGCCTGAACTGGAGAAAGGAGG - Intronic
926118700 2:10229305-10229327 AAGCGTGAACAGGGGGAGGGTGG + Intergenic
926128488 2:10286117-10286139 CAGAGGGAAGCTGAGGAGGGCGG + Intergenic
927641718 2:24849741-24849763 CAGAGGGGAAAGGAGGAGGGGGG + Intronic
929115816 2:38443137-38443159 CTGACTGATCTGGAGGAGCGGGG - Intergenic
929873418 2:45776699-45776721 CAGAGTGTCATGGTGGAGGGAGG - Intronic
929996367 2:46828640-46828662 GAGACTGCCCTGGAGGAGGGAGG - Intronic
930046414 2:47176547-47176569 CGGAGGGATCTGGCGGAGGGAGG - Exonic
930208202 2:48609300-48609322 AAGGGTGGACTGGAGGATGGAGG - Intronic
930887782 2:56347703-56347725 CAGAGTGAACTGGAGGAGGGTGG + Intronic
931222657 2:60302075-60302097 CAGAGTGAACTTGGGGAAGCGGG + Intergenic
931915192 2:66946910-66946932 CAGAGAGGAATGGAAGAGGGTGG - Intergenic
932357044 2:71075637-71075659 CAGAAGGTACTGGAGGTGGGGGG + Exonic
933519875 2:83357782-83357804 TAGAGTGAAATGGAGTGGGGAGG + Intergenic
934545076 2:95207658-95207680 CTGAGTGTCCGGGAGGAGGGTGG + Exonic
934948273 2:98557912-98557934 CAGAGTGTACAGGAGGAAGGCGG - Intronic
936409083 2:112238091-112238113 TAGAGGGAGCTGGAGGATGGAGG - Intronic
937264188 2:120605823-120605845 CAGAGTGAGGTGGAAGGGGGTGG + Intergenic
937689434 2:124738235-124738257 CAGAGTGAAAAGAAAGAGGGAGG - Intronic
937954339 2:127412091-127412113 CACAGACAACTGGATGAGGGAGG - Intergenic
938114163 2:128592069-128592091 CAGAGTGCAGTGGAGGAGGCTGG + Intergenic
938546023 2:132332490-132332512 CAGAATGAGCTGCAGGAAGGCGG + Intergenic
939652721 2:144785121-144785143 GAGAGTGAGCTGAAGCAGGGTGG + Intergenic
939930842 2:148231072-148231094 GACAGTGGACTGGAGGAGGGGGG - Intronic
940090871 2:149915414-149915436 ACGAGCGTACTGGAGGAGGGTGG + Intergenic
940271801 2:151899110-151899132 CAGGTTGAACTGGAGGAGAGAGG + Intronic
940493205 2:154391497-154391519 CAGATGGAACTGGAAGAGTGGGG + Intronic
940578662 2:155549091-155549113 CAGAGTGAAGTGGGGTGGGGGGG + Intergenic
941113744 2:161447795-161447817 CAAAGTGACCTGGTGGAGGATGG + Intronic
942076157 2:172358957-172358979 AAAAGTGAACTGCATGAGGGAGG - Intergenic
942525730 2:176850584-176850606 CAGAGTGGGCTGGAGGTGGAAGG + Intergenic
943913742 2:193601688-193601710 AAGAGTGAATTGGTGGAGAGAGG + Intergenic
944856746 2:203775490-203775512 CAGAGCAAGCTGGAGGATGGGGG - Intergenic
945207147 2:207344304-207344326 CAGAGGGAGCTGAAGCAGGGTGG + Intergenic
946109744 2:217404128-217404150 GAGACTCAACTGGAGGAGGGAGG - Intronic
946416497 2:219542803-219542825 CAGGGTGAGATGGGGGAGGGAGG - Intronic
947638824 2:231694499-231694521 CAGAAGGAACTGGTGGAGGTGGG - Intergenic
948063839 2:235062023-235062045 CAGACAGAGATGGAGGAGGGAGG + Intergenic
948549945 2:238764623-238764645 CAGAGCCAAGTGAAGGAGGGAGG + Intergenic
948883676 2:240872741-240872763 CAGAGGGAGCTGGGGGAGTGAGG - Intronic
949080144 2:242089435-242089457 CAGAGTGGCCTGGAGGAATGAGG - Intergenic
1169130865 20:3165858-3165880 ATGAGTGCACTGGGGGAGGGCGG + Exonic
1169144320 20:3242484-3242506 CTGAGTGGAATGGAGGATGGAGG - Intergenic
1169411959 20:5378659-5378681 AAGAGGGAACTGGAGGTAGGGGG + Intergenic
1170045466 20:12080599-12080621 CAGAGTGAGATGGAGAAGGAGGG - Intergenic
1170214154 20:13874142-13874164 AAGAGAGAACTGGAGGAATGTGG + Intronic
1170518966 20:17163382-17163404 CAGAATGAACTGTAGGTGTGTGG + Intergenic
1171874886 20:30565223-30565245 CAGAATGAGCTGCAGGAAGGCGG + Intergenic
1172474225 20:35225756-35225778 AAAAGTGTAATGGAGGAGGGTGG - Intergenic
1172782913 20:37447783-37447805 CAGAGGAAACAGGAGAAGGGTGG - Intergenic
1173010951 20:39181500-39181522 CAGGGAGACCTGGATGAGGGTGG + Intergenic
1173554256 20:43954418-43954440 CAGAGTCCACTGCAGGAGGCAGG - Intronic
1173811874 20:45960761-45960783 GAGAAAGAAGTGGAGGAGGGAGG + Intronic
1173999287 20:47362604-47362626 CAGAGTGAGCCACAGGAGGGTGG - Intergenic
1174304914 20:49608329-49608351 TGGAGTGAAAGGGAGGAGGGAGG - Intergenic
1174351846 20:49974248-49974270 CAGAGGGAAAGGGAGGAGAGGGG + Intergenic
1174465121 20:50711392-50711414 CAGAATCAACTGGAGAGGGGAGG + Intergenic
1174592736 20:51658981-51659003 CAGAGGGAACGGGAGGAAGATGG - Intronic
1174867589 20:54152266-54152288 CAGCCTGAACTGAAGGAGTGTGG + Intergenic
1174909928 20:54596517-54596539 CAGACTGAACTGGAAGTTGGAGG + Intronic
1175129479 20:56778819-56778841 CACAGTGGGCTGGAGCAGGGGGG - Intergenic
1175563722 20:59955241-59955263 CAGTGAGAACTGGAGGTGGCTGG + Intergenic
1175691340 20:61067984-61068006 CAGAGGGAACTTGAGGTGAGAGG + Intergenic
1175840042 20:62020931-62020953 CAGCGTGAACATGAGGAAGGAGG + Intronic
1176268186 20:64221582-64221604 CGGAGTGATGTGGCGGAGGGAGG + Intronic
1176752324 21:10700794-10700816 CAGAGTGCACTGGAGTGGAGTGG - Intergenic
1176796294 21:13373019-13373041 CAGCCTGAGCTGTAGGAGGGTGG - Intergenic
1177112136 21:17041431-17041453 CAGGGTAAAGTGTAGGAGGGGGG - Intergenic
1177191431 21:17856158-17856180 GAGAGTGATTTGGATGAGGGTGG - Intergenic
1177806056 21:25875777-25875799 CAGAATGAACAGGAAGAGGAAGG + Intergenic
1178215948 21:30598526-30598548 CAGAGGGTACTGGGGGTGGGAGG + Intergenic
1178371154 21:32028672-32028694 AAGAGTGAACTGGTCTAGGGTGG - Intronic
1178472271 21:32904201-32904223 CAAAGGGAACTGTAGAAGGGTGG - Intergenic
1179886238 21:44315362-44315384 CAGGGTGCACTGGGGCAGGGAGG + Intronic
1180534778 22:16387632-16387654 CAGAGTGTCCTGGGGGAGGCAGG + Intergenic
1180635632 22:17261037-17261059 CAGAATGTCCTGGTGGAGGGGGG + Intergenic
1182057300 22:27369661-27369683 CAGAGTGAGGGGGAGGAGGAGGG + Intergenic
1183319449 22:37156152-37156174 CAGAGGGAACAGGAGGCTGGAGG - Intronic
1183346304 22:37310192-37310214 CCGAGTGCTCTGGAGGAGGATGG - Intronic
1183521565 22:38298698-38298720 CAGAGTGAGCTGGTGGCGGGAGG - Intronic
1183811163 22:40258875-40258897 CAGAGTGACCTGCAGGACTGAGG - Intronic
1184097305 22:42323455-42323477 CTGAGGGAACAGGAGGACGGTGG + Intronic
1184301748 22:43564970-43564992 CAGGGTGAACAGAAGCAGGGGGG - Intronic
1184467324 22:44676611-44676633 CGGGGTGAAGAGGAGGAGGGGGG + Intronic
1184474080 22:44711328-44711350 CAGAGGGAACAGCAGGATGGAGG + Intronic
1184523948 22:45010363-45010385 CAGAGGGAGGCGGAGGAGGGGGG - Intergenic
1184775188 22:46619637-46619659 CAGAGTGAACAGGAGGACCGGGG - Intronic
1184808206 22:46810109-46810131 CTGGGTGTTCTGGAGGAGGGAGG + Intronic
1184877068 22:47282725-47282747 CAGAGTAAGCTGGAGGCTGGGGG - Intergenic
1185051222 22:48555309-48555331 GAGAGCGAAAGGGAGGAGGGAGG - Intronic
1185418617 22:50722846-50722868 CAGAGAGGATGGGAGGAGGGAGG - Intergenic
1203303943 22_KI270736v1_random:96304-96326 CAGAGTGGAGTGGAGAAGAGTGG + Intergenic
1203306737 22_KI270736v1_random:114465-114487 TAGAGTGGACTGGAGTAGAGTGG + Intergenic
949226886 3:1705531-1705553 GAGGGTGAACTGAAGCAGGGTGG + Intergenic
949588486 3:5467507-5467529 CACAGTGAATTAGAGGAGAGGGG - Intergenic
949736452 3:7177582-7177604 CAGAGTGACATGGAGGAGACAGG + Intronic
949789053 3:7772742-7772764 CAGAGTGTGATGGAGGAGGTGGG + Intergenic
950376971 3:12580132-12580154 CAGAGTGAACTGGAGGCTTTTGG + Intronic
950893667 3:16428198-16428220 CAGAATGAACTCGAGAAGGGAGG + Intronic
951614489 3:24525996-24526018 CTGAAAGAATTGGAGGAGGGAGG + Intergenic
951906628 3:27713649-27713671 CAGAAAGAACTTGAGGAGGAGGG - Intergenic
952078838 3:29732056-29732078 TAGAGTGATGTGGAGGAGAGAGG - Intronic
952101738 3:30021352-30021374 CAGAGTGACCTGGATGAGATTGG + Intergenic
952887530 3:38020760-38020782 CAGAGTGAACTGAAGGAAGCTGG + Intronic
952916627 3:38250818-38250840 CAGAGGGAACAGGAGGACTGCGG - Intronic
953106280 3:39883241-39883263 AAGAGTGAACTGGATGTGGAAGG + Intronic
954111414 3:48435429-48435451 CAGAGAGACCTGGAGGATGTAGG - Intronic
954608937 3:51934130-51934152 TAGGGTGACCTGGGGGAGGGTGG - Intronic
954802879 3:53197272-53197294 CAGAGTGAAGTTGGGGGGGGCGG - Intergenic
955737702 3:62057322-62057344 CAGTGTAAACTGGAGGATGAAGG - Intronic
956301989 3:67781911-67781933 GAGGGTGAACTGAAGCAGGGTGG - Intergenic
957378373 3:79390692-79390714 CAGAGGGAAATGGTGAAGGGAGG + Intronic
957824956 3:85429699-85429721 CATAGTAAAATGGAGGAGGTTGG + Intronic
959093157 3:101925334-101925356 GAGAGTGAGCTGAAGCAGGGTGG - Intergenic
960197779 3:114791935-114791957 CTGAGTCAACTGGAAAAGGGAGG - Intronic
960581267 3:119281167-119281189 CTTAGTGGACTGGAGCAGGGAGG - Intergenic
960640390 3:119817390-119817412 CAGACTGAACTGGGGGTGGGGGG - Exonic
960787732 3:121392375-121392397 GAGAGTGAGCTGAAGCAGGGTGG - Intronic
962058236 3:131897165-131897187 CACAGAGAACTGGATGAGAGAGG + Intronic
962206942 3:133442539-133442561 CAGAATGCATTGGAGGAGGGAGG + Intronic
962675144 3:137750846-137750868 GAGAGTGAGCTGAAGCAGGGCGG + Intergenic
963388192 3:144623264-144623286 CAGAGTAAGCTGGAAAAGGGTGG + Intergenic
963718292 3:148830117-148830139 CAGAGTGAACTGGAAGCAGATGG - Intronic
964808799 3:160640367-160640389 CAGACAGATCTTGAGGAGGGAGG - Intergenic
965604455 3:170484845-170484867 CAGGGTGGGCTGGAGGAGAGTGG + Intronic
966016855 3:175150709-175150731 CAGAGTGAGCAGCAGAAGGGAGG - Intronic
966649328 3:182281739-182281761 CAGAGTGTAATGGAGGCAGGAGG - Intergenic
966946960 3:184783545-184783567 TAGAATAAACTGGAGGATGGGGG + Intergenic
969098705 4:4752961-4752983 CAGAGTTAACTGGGGGCAGGGGG - Intergenic
969365196 4:6690125-6690147 CAGAGAGGCCAGGAGGAGGGCGG - Intergenic
969545560 4:7824748-7824770 CTGAGGGAACGGGAGGAAGGGGG + Intronic
969704061 4:8782571-8782593 GAGGGGGAACTGGAGTAGGGAGG + Intergenic
971480218 4:27108355-27108377 CACAGTGGATTGGAGGAGAGAGG + Intergenic
972188606 4:36563232-36563254 CAGAGTGACCTGGATGAGATTGG - Intergenic
975449274 4:74505471-74505493 AAGAGTGAGCTGAAGCAGGGTGG + Intergenic
976222590 4:82769791-82769813 CAGAGTGAGAGGGAGGAAGGGGG + Intronic
977409049 4:96637966-96637988 TAGAGTCAACTGCAGGAGTGGGG + Intergenic
977705383 4:100064887-100064909 CAGAGAGAAGGGAAGGAGGGAGG - Intergenic
978108190 4:104930405-104930427 GAGAGTGAGCTGAAGCAGGGTGG + Intergenic
978342009 4:107728923-107728945 CAGGGTGAACAGGATGATGGTGG + Intergenic
979092310 4:116500439-116500461 CAGAGTTCACTGGATGAGTGTGG + Intergenic
979439453 4:120734105-120734127 CAGAGTGTCCAGGAGGAAGGGGG + Intronic
979659529 4:123237847-123237869 GAGAGTGAACTGAAATAGGGTGG + Intronic
979904085 4:126262482-126262504 CAGAGTAGACTGGGGTAGGGAGG + Intergenic
980106660 4:128594721-128594743 CAGAGTAAGCTGGAGGGAGGGGG - Intergenic
980583722 4:134786901-134786923 GAGAGTGAGCTGAAGCAGGGTGG - Intergenic
983639670 4:169933409-169933431 TAGAGTGACCTGGGGGAGGATGG + Intergenic
983859760 4:172691075-172691097 CAGTGAGCACTGGAGGAGGCAGG + Intronic
984927932 4:184822942-184822964 CTTAGTGAACTGGAGAAGGCAGG - Intronic
984994236 4:185412907-185412929 AAGAGTGAATTGGCGGAGGGTGG - Intronic
985558459 5:569617-569639 CAGCGGGGTCTGGAGGAGGGAGG - Intergenic
985670751 5:1205431-1205453 CAGAGAGGACTGGGGGTGGGGGG - Intronic
986192352 5:5509286-5509308 CAGAGTGAACTGAGGTAGGAGGG + Intergenic
986422137 5:7596277-7596299 CAGAGCTAACTGGTGGGGGGGGG - Intronic
986486278 5:8241674-8241696 GAGAGTGAATTGCAGGAGGTGGG + Intergenic
986543848 5:8874100-8874122 GACAGTGAGCTGGAGGTGGGGGG - Intergenic
986805126 5:11301966-11301988 GTGGGTAAACTGGAGGAGGGTGG + Intronic
987455700 5:18143319-18143341 CAGTGTGATTTGGGGGAGGGGGG + Intergenic
989987205 5:50714780-50714802 CACAGTCAGCTGCAGGAGGGAGG - Intronic
990380744 5:55220487-55220509 CACAGTGAGCTGGAGGAGGGCGG - Exonic
990986966 5:61649582-61649604 CAGAGTGCACAGGGGGAAGGTGG - Intronic
992492421 5:77258341-77258363 CAGAGTGAACTGATGGAGCATGG + Intronic
993552483 5:89291092-89291114 CAGAATGTGCGGGAGGAGGGGGG - Intergenic
993742209 5:91555534-91555556 GAGTGTGAGCTGAAGGAGGGCGG + Intergenic
995387518 5:111604207-111604229 CAGAGACAAGTGGAGGAGTGAGG - Intergenic
995551414 5:113285499-113285521 CAGAGTGAGCAGGGGGAGAGTGG - Intronic
996592189 5:125160540-125160562 GAGAGTGAACAGAAGCAGGGTGG + Intergenic
996795398 5:127341151-127341173 CAGAATGAACTGGTGAAGTGGGG - Intronic
998092553 5:139379826-139379848 CAGCATGATCTGAAGGAGGGGGG + Exonic
999243040 5:150138553-150138575 CAGTCTGAAAGGGAGGAGGGAGG - Intronic
999262158 5:150244931-150244953 GAGGGGGGACTGGAGGAGGGTGG - Intronic
999684364 5:154089030-154089052 GGGTGTGAACTGGAGGAAGGGGG + Intronic
1000555330 5:162718546-162718568 CACAGAGACCTTGAGGAGGGAGG - Intergenic
1001134370 5:169090226-169090248 GAGGGTGAAGGGGAGGAGGGAGG + Intronic
1001229397 5:169972974-169972996 CAGAAACAACTAGAGGAGGGAGG + Intronic
1001570748 5:172729046-172729068 CACAGTGAACTGGAGCAGATTGG - Intergenic
1001954895 5:175842517-175842539 CCCAGTGAACTCGAGGAGGAAGG - Intronic
1002064754 5:176646508-176646530 CAGACTGAAGTGGAGGTGGAGGG + Exonic
1002493534 5:179596763-179596785 CAGCACGAACGGGAGGAGGGGGG + Intronic
1003022620 6:2524324-2524346 CAGAGGGCACTGCAGGAGGAAGG - Intergenic
1003496019 6:6663868-6663890 CACAGAGCGCTGGAGGAGGGAGG - Intergenic
1003521486 6:6862325-6862347 AAGAGGGAACTAGAGGAGGTTGG + Intergenic
1003666089 6:8112617-8112639 CAGGATGAATTGGAGGAGGAAGG - Intergenic
1003953914 6:11144752-11144774 GAGAGTGAATGGGAGGAGAGTGG + Intergenic
1003980013 6:11380576-11380598 CAGTGAGGCCTGGAGGAGGGAGG + Intronic
1004657628 6:17679656-17679678 GAGAGAGAACAGGAGGTGGGAGG + Intronic
1004752843 6:18581591-18581613 GAGAGAGAAGTGGGGGAGGGAGG - Intergenic
1005955460 6:30660302-30660324 CAGAGTTAACTGGATGAGAGGGG + Intronic
1006278104 6:33022221-33022243 GAGGGTGAACTAGAGGAGGTGGG - Intergenic
1007183477 6:39947854-39947876 CAGAGAGCACTGGAAGAGGCTGG - Intergenic
1007364779 6:41383680-41383702 CAGTGTGGACCAGAGGAGGGAGG + Intergenic
1007382930 6:41502416-41502438 CAGAGTGAACAGGAGCGGGCAGG + Intergenic
1007638472 6:43316046-43316068 CAGATTGGAGTGGAGGAGGTAGG - Intronic
1007998508 6:46334493-46334515 GAGAGTGAACCTGAGAAGGGAGG + Intronic
1008027259 6:46652770-46652792 CAAAGAGAAGTGGAGGTGGGAGG - Exonic
1009988155 6:70806476-70806498 GAGGGTGAGCTGAAGGAGGGCGG - Intronic
1010455284 6:76047605-76047627 CAAGGTGAACTGGAGAGGGGAGG - Intronic
1010585819 6:77657885-77657907 TAGTGTGAACAGGAGGAGGAGGG - Intergenic
1011186147 6:84677735-84677757 CTGAGTGAATAGGAGGAAGGTGG - Intergenic
1011277149 6:85642726-85642748 TGGAGTGAGCTGGGGGAGGGTGG - Intronic
1011298319 6:85847428-85847450 GAGAGTGAGCTGAAGAAGGGTGG - Intergenic
1011722840 6:90176779-90176801 AAGCATGAACTGGAGGAGGCAGG - Intronic
1012306837 6:97669198-97669220 GAAAGGGAACTGGGGGAGGGAGG - Intergenic
1012459532 6:99445018-99445040 CAGAGAGAAGTGGAGAAAGGGGG - Intronic
1013619143 6:111872423-111872445 AAGAGTGAAGGGGAGGATGGGGG + Intronic
1015181238 6:130365296-130365318 CAGAGGGAACTGAAGCACGGGGG - Intronic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1015270229 6:131330372-131330394 CAGAGTGGACTCAAGTAGGGAGG + Intergenic
1015897858 6:138034489-138034511 CAGAGAGAACTGGAGGAGCTCGG + Intergenic
1016176176 6:141080283-141080305 GAGAGGGAACTGGGGGTGGGTGG + Intergenic
1016239401 6:141911069-141911091 CAGAGAGATCTGCAGGAGGTTGG + Intergenic
1016461911 6:144286469-144286491 CTGAGGGGACAGGAGGAGGGGGG + Intronic
1017392658 6:153958283-153958305 CAGAGTGAACAGGCTGATGGGGG + Intergenic
1017445100 6:154500539-154500561 GAGAGGGAACTTAAGGAGGGAGG - Intronic
1017866588 6:158449241-158449263 TAGACTGATGTGGAGGAGGGAGG + Intronic
1018316493 6:162561911-162561933 GACAGTGAACTGGGGGTGGGAGG + Intronic
1018593239 6:165451278-165451300 TAGCTTGAACTGGAGCAGGGTGG - Intronic
1018650299 6:165987037-165987059 CACTGAGAACTGGAGAAGGGCGG + Intergenic
1018887378 6:167951479-167951501 CATAGTGGACTGGAGGTGGCGGG - Exonic
1019071976 6:169354150-169354172 GAGGGTGAGCTGAAGGAGGGTGG - Intergenic
1019318918 7:406038-406060 CAGGGTGGTCTGGAGGAGGGAGG - Intergenic
1019376365 7:694616-694638 CAGAATGCACTGGAGGTGGGTGG - Intronic
1019388296 7:770844-770866 CAGAGTGCTGTGGGGGAGGGAGG - Intronic
1019453508 7:1112385-1112407 CAGAGTGAGCAGGTGGAGGCCGG - Intronic
1019907084 7:4072954-4072976 CAGAGTTTACTGAAGGAGAGTGG - Intronic
1019964858 7:4490549-4490571 CAGAGTGTAATGGAGGAGTTTGG - Intergenic
1023164375 7:37328747-37328769 CAGAGTGAGCTTGAGCAGAGAGG - Intronic
1023694636 7:42832129-42832151 CAGAGTGAATTGTAGGATGGAGG - Intergenic
1023734964 7:43226716-43226738 GAGAGTGCAAGGGAGGAGGGTGG + Intronic
1023828977 7:44028413-44028435 CACAGTGACCTGGATCAGGGTGG - Intergenic
1024178013 7:46860992-46861014 GAGGGTGAGGTGGAGGAGGGAGG - Intergenic
1024178141 7:46861785-46861807 GAGAGTTAAGAGGAGGAGGGTGG + Intergenic
1024998604 7:55295208-55295230 GAGGGTGAACTGAAGCAGGGTGG - Intergenic
1025753482 7:64312945-64312967 CAGAGTTTACTGGAGGTGGCAGG - Intronic
1026286801 7:68970478-68970500 CAGAATGAACTGGAACAAGGAGG + Intergenic
1026988704 7:74570958-74570980 AAAAGGGAACTGGAGAAGGGTGG - Intronic
1028257459 7:88617302-88617324 CAGAGTCATCTGGAAGATGGAGG + Intergenic
1028459274 7:91072336-91072358 TGGAGTGAACTTGAGGAGGCTGG - Intronic
1028723357 7:94059126-94059148 CACTGTGCACTGGAGGATGGAGG - Intergenic
1029039290 7:97556069-97556091 AAGAGTGAACTGCAGGCGGATGG - Intergenic
1029200648 7:98837052-98837074 CAGAGTGACCAGGTGGAGGTTGG - Intergenic
1029286137 7:99467413-99467435 CAGAATGAACTGAACGAGGGTGG - Intergenic
1029362638 7:100098462-100098484 AAGAGGGAAGTGCAGGAGGGAGG - Intronic
1029479829 7:100805617-100805639 CAGCATGAGCTGGTGGAGGGAGG + Exonic
1029739276 7:102482670-102482692 CACAGTGACCTGGATCAGGGTGG - Intronic
1029757277 7:102581849-102581871 CACAGTGACCTGGATCAGGGTGG - Exonic
1029775217 7:102680910-102680932 CACAGTGACCTGGATCAGGGTGG - Intergenic
1030070252 7:105692149-105692171 CAGAGAGAACTGGTTGGGGGAGG + Intronic
1030225572 7:107146648-107146670 CTGACTGGACTGGAGGAGTGGGG - Intronic
1030293344 7:107893638-107893660 CTGAGTGAAGTGGGGGAGTGAGG + Intronic
1033274542 7:139961461-139961483 CATAATGAGCTGGAGGAGGTGGG - Intronic
1033653006 7:143356124-143356146 AAGAGTGAAATGGAGAAAGGAGG + Exonic
1033801809 7:144910650-144910672 CAGAGGGGAGTGGGGGAGGGAGG - Intergenic
1034860203 7:154588206-154588228 CAGAGTGTCCCAGAGGAGGGAGG + Intronic
1034918464 7:155059971-155059993 CAGAGTGCACTGGTCGGGGGAGG - Intergenic
1034990358 7:155544126-155544148 CAGTGTGAATTTGAGGAGGGTGG + Intergenic
1035476188 7:159145293-159145315 TAGAGAGAACTGGGGGAGAGCGG + Intergenic
1035538186 8:407698-407720 CAGAGTGGCCTGGAGGAATGAGG - Intronic
1036425403 8:8641386-8641408 CAGAGTGTGTAGGAGGAGGGAGG - Intergenic
1036782435 8:11658884-11658906 CAGAGTGAAGCAGGGGAGGGAGG - Intergenic
1037104003 8:15082471-15082493 GAGAGAGAAATGGGGGAGGGTGG + Intronic
1037908208 8:22727864-22727886 CTGAGTGGAGGGGAGGAGGGAGG - Intronic
1038070045 8:24003745-24003767 GAGAGTGATGTGGAAGAGGGTGG + Intergenic
1038348676 8:26756437-26756459 AAGAATGAAATGGGGGAGGGAGG + Intronic
1038383678 8:27120748-27120770 GAGAGTGGAGTGGAGGAGTGGGG - Intergenic
1039573118 8:38602692-38602714 TATAGAGAACTGGAGCAGGGTGG + Intergenic
1040672124 8:49704424-49704446 CAGGGTGACCTGGGGGATGGTGG - Intergenic
1040940788 8:52830732-52830754 GAGAGGGAACTGGAGGAGAGAGG - Intergenic
1041350340 8:56942039-56942061 CAGAGTAAAATGGAGTAGGTTGG + Intergenic
1041893097 8:62893578-62893600 CAGTGTGAACTGGAGAAGTGAGG + Intronic
1044623723 8:94216337-94216359 CACAGTGCAGTGGAGGAGGAGGG + Intronic
1044744338 8:95357621-95357643 TAGAGGGATCTGGAGGAGGGAGG + Intergenic
1044847775 8:96398882-96398904 GAGAGTGAAAAGGAGGAGGAGGG - Intergenic
1045135960 8:99218719-99218741 CAGAATGAATGGGAGGTGGGTGG + Intronic
1045690951 8:104759313-104759335 GAGAGTGAAATGGAGAAGGAGGG + Intronic
1045802529 8:106117936-106117958 GAGTGTGAACTGAAGCAGGGTGG - Intergenic
1046354166 8:113057160-113057182 CATAGTGAACTGCAGTAGGGAGG - Intronic
1046510730 8:115199109-115199131 AAGAGGTAACTGGAGAAGGGAGG + Intergenic
1048064491 8:130953768-130953790 CAGAGTGAAGTAGAGGTGAGAGG - Intronic
1048251429 8:132869581-132869603 GAGAGTGGAGTGGAGAAGGGTGG - Intronic
1048911987 8:139144017-139144039 CAGATGGAACTGCATGAGGGAGG - Intergenic
1049324830 8:142016451-142016473 CAGAGAGGCCTGGAGGAGGACGG - Intergenic
1050191107 9:3027391-3027413 CAAAGTGAAGAGGAGGAGGCTGG + Intergenic
1050377041 9:4984722-4984744 CAGCCTGCACTGGAGGAGGCCGG - Intergenic
1055261095 9:74434683-74434705 CAGGTTGAACTGGAGATGGGTGG - Intergenic
1055750665 9:79501176-79501198 CAGAGAGAAAAGGGGGAGGGTGG + Intergenic
1056485706 9:87055072-87055094 CAGAGAGAAAAGGAGGTGGGAGG + Intergenic
1057022185 9:91707843-91707865 CAGTGTGGACAGGAGGATGGGGG + Intronic
1058744654 9:107978526-107978548 GAGAGTGAATTGGAGGTGGGGGG - Intergenic
1058767344 9:108194647-108194669 GAGAATGAGCTGGAGGAGGCAGG - Intergenic
1058906122 9:109484028-109484050 CAGAGTGAAGAGGAGGAAGTTGG - Intronic
1059033698 9:110730272-110730294 CACAGTGAATTGGAGAAGGATGG + Intronic
1060212590 9:121719636-121719658 CAGATTAGACTGGGGGAGGGAGG + Intronic
1060732893 9:126049309-126049331 CTGAGGGGTCTGGAGGAGGGAGG + Intergenic
1060886225 9:127154291-127154313 CAGGGTGTCCTGGAGAAGGGTGG + Intronic
1061274414 9:129561279-129561301 CAGAGGGTTCTGGAAGAGGGGGG + Intergenic
1062039265 9:134396642-134396664 CAGGGTGCCCGGGAGGAGGGAGG - Intronic
1062137547 9:134937733-134937755 CAGAGCTGACTGGAGGAGGCAGG - Intergenic
1062207087 9:135343180-135343202 CAGTGGGACCTGGTGGAGGGTGG - Intergenic
1203346087 Un_KI270442v1:35453-35475 CAGAGTGGAGTGGAGTAGAGTGG + Intergenic
1185512541 X:674206-674228 GAGGTTGTACTGGAGGAGGGTGG - Intergenic
1185648085 X:1629295-1629317 CAGAGAGGACAGGAGGAGAGAGG + Intronic
1186533913 X:10327878-10327900 CAGCGTCAACTAGAGGATGGAGG + Intergenic
1187007476 X:15246803-15246825 CAAAGTGCACTGGGTGAGGGGGG + Intronic
1187377118 X:18764980-18765002 AAGATTGAACAGGAGGAGGTGGG + Intronic
1188518492 X:31012760-31012782 CAGATAGAAGTGGTGGAGGGTGG - Intergenic
1189382861 X:40514062-40514084 CAGGGTGGAGTGAAGGAGGGAGG + Intergenic
1190255051 X:48756102-48756124 CAGAGTGAAATGAATGATGGAGG + Intergenic
1191079635 X:56495421-56495443 GAGAGTGAGCTGAAGCAGGGTGG - Intergenic
1191237819 X:58150496-58150518 GAGAGTGAGCTGAAGCAGGGTGG + Intergenic
1193730284 X:85094883-85094905 CAGATTGAACTGGAGAAGAAAGG + Intronic
1194564961 X:95474127-95474149 CAGTGTCAACTGCAGGAGAGAGG - Intergenic
1195914281 X:109920707-109920729 CAGAATAAACTGGAGAAGGGGGG - Intergenic
1196758669 X:119180087-119180109 CAGAATCACCTGGAGGAGGAGGG - Intergenic
1196758948 X:119182359-119182381 CAGAATCACCTGGAGGAGGAGGG - Intergenic
1198725866 X:139676295-139676317 GAGGGTGAACTGAAGCAGGGTGG - Intronic
1199493558 X:148427650-148427672 TGGGGTGAACTGGAAGAGGGAGG - Intergenic
1200253107 X:154564278-154564300 CAGAGGGAAGGGGAGGATGGAGG - Intronic
1200264660 X:154640137-154640159 CAGAGGGAAGGGGAGGATGGAGG + Intergenic
1201104379 Y:10752616-10752638 CAGAGTGAATTGGAGTGGAGTGG - Intergenic
1201131403 Y:10954535-10954557 CAGAGTGGAATGGAGTAGAGTGG - Intergenic
1201136706 Y:10995557-10995579 CAGAGTGGAGTGGAGGGGAGTGG - Intergenic
1201141148 Y:11029847-11029869 CAGAGTGGACTGGAGTGGAGTGG - Intergenic
1202607556 Y:26651874-26651896 CAGAGTGGAGTGGAGTAGGGTGG + Intergenic