ID: 930892872

View in Genome Browser
Species Human (GRCh38)
Location 2:56411534-56411556
Sequence CTAGACAGTGAGGTTATTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930892872_930892879 25 Left 930892872 2:56411534-56411556 CCTAAAATAACCTCACTGTCTAG No data
Right 930892879 2:56411582-56411604 CAGCAGCACTTCCCCTCTTCTGG No data
930892872_930892874 -10 Left 930892872 2:56411534-56411556 CCTAAAATAACCTCACTGTCTAG No data
Right 930892874 2:56411547-56411569 CACTGTCTAGAAGACCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930892872 Original CRISPR CTAGACAGTGAGGTTATTTT AGG (reversed) Intergenic
No off target data available for this crispr